CRISPR

CRISPR1-gfi1b

ID
ZDB-CRISPR-190205-1
Name
CRISPR1-gfi1b
Previous Names
None
Target
Sequence
5' - GGAGGAAACTCTGCCAGCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
qmc554 gfi1b
szy9 gfi1b
zko3611A gfi1b
Expression
Gene expression in Wild Types + CRISPR1-gfi1b
No data available
Phenotype
Phenotype resulting from CRISPR1-gfi1b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gfi1b
Phenotype Fish Conditions Figures
erythroblast gfi1aa expression increased amount, abnormal gfi1bqmc554/qmc554 standard conditions Fig. 4 from Moore et al., 2018
posterior lateral mesoderm kdrl expression increased distribution, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/+ standard conditions Fig. 5 from Moore et al., 2018
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/+ standard conditions Fig. 6 from Moore et al., 2018
nucleate erythrocyte morphology, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/+ standard conditions Fig. 7 from Moore et al., 2018
erythroblast increased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/+ standard conditions Fig. 7 from Moore et al., 2018
posterior lateral mesoderm kdrl expression increased distribution, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 5 from Moore et al., 2018
erythroblast slc4a1a expression decreased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 7 from Moore et al., 2018
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 6 from Moore et al., 2018
erythroblast zfp36l2 expression increased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 7 from Moore et al., 2018
erythroblast nucleus structure, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 6 from Moore et al., 2018
nucleate erythrocyte morphology, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 7 from Moore et al., 2018
erythroblast increased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 7 from Moore et al., 2018
nucleate erythrocyte nucleus morphology, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 7 from Moore et al., 2018
erythroblast immature, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 6 from Moore et al., 2018
erythroblast hemoglobin decreased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 6 from Moore et al., 2018
erythroblast etsrp expression increased amount, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 7 from Moore et al., 2018
definitive erythrocyte differentiation decreased occurrence, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 6 from Moore et al., 2018
endothelial cell hbbe1.1 expression absent, abnormal gfi1aaqmc551Gt/qmc551Gt; gfi1bqmc554/qmc554 standard conditions Fig. 7 from Moore et al., 2018
endothelial cell clec14a expression increased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell sptb expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell sptb expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 1 with image from Wu et al., 2022
endothelial cell clec14a expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal gfi1aaszy5/szy5; gfi1abszy10/szy10; gfi1bszy9/szy9 standard conditions FIGURE 2 with image from Wu et al., 2022
Citations