CRISPR

CRISPR1-sema3fa

ID
ZDB-CRISPR-190204-1
Name
CRISPR1-sema3fa
Previous Names
None
Target
Sequence
5' - GAAGACTCGTGGAACAGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ca304 sema3fa
zf3897 sema3fa
Expression
Gene expression in Wild Types + CRISPR1-sema3fa
No data available
Phenotype
Phenotype resulting from CRISPR1-sema3fa
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sema3fa
Phenotype Fish Conditions Figures
whole organism sema3fa expression decreased amount, abnormal sema3faca304/ca304 standard conditions Fig. 1 with image from Halabi et al., 2021
retinal neural layer deformed, abnormal sema3faca304/ca304 standard conditions Fig. 4 with image from Halabi et al., 2021
optic choroid vascular plexus capillary displaced to retinal outer nuclear layer, abnormal sema3faca304/ca304 standard conditions Fig. 4 with image from Halabi et al., 2021
whole organism sema3fa expression absent, abnormal sema3faca304/ca304 standard conditions Fig. 1 with image from Halabi et al., 2021
optic choroid vascular plexus capillary increased permeability, abnormal sema3faca304/ca304 standard conditions Fig. 4 with image from Halabi et al., 2021
whole organism increased length, abnormal WIK + CRISPR1-sema3fa + CRISPR2-sema3fa control Fig. S3 with image from van der Klaauw et al., 2019
whole organism increased weight, abnormal WIK + CRISPR1-sema3fa + CRISPR2-sema3fa control Fig. S3 with image from van der Klaauw et al., 2019
hyaloid vessel increased branchiness, abnormal sema3faca304/+; ci5Tg standard conditions Fig. 2 with image from Halabi et al., 2021
hyaloid vessel blood vessel remodeling decreased occurrence, abnormal sema3faca304/+; ci5Tg standard conditions Fig. 2 with image from Halabi et al., 2021
optic choroid vascular plexus increased size, abnormal sema3faca304/+; ci5Tg standard conditions Fig. 4 with image from Halabi et al., 2021
optic choroid vascular plexus capillary increased permeability, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 5 with image from Halabi et al., 2021
hyaloid vessel increased branchiness, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 2 with imageFig. 3 with image from Halabi et al., 2021
hyaloid vessel peripheral region has extra parts of type hyaloid capillaries filopodium, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 3 with image from Halabi et al., 2021
hyaloid vessel decreased length, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 3 with image from Halabi et al., 2021
hyaloid vessel blood vessel remodeling decreased occurrence, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 2 with imageFig. 3 with image from Halabi et al., 2021
hyaloid vessel decreased width, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 3 with image from Halabi et al., 2021
optic choroid vascular plexus increased size, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 4 with image from Halabi et al., 2021
optic choroid vascular plexus capillary displaced to photoreceptor outer segment layer, abnormal sema3faca304/ca304; ci5Tg standard conditions Fig. 5 with image from Halabi et al., 2021
Citations