CRISPR

CRISPR1-ky

ID
ZDB-CRISPR-190109-1
Name
CRISPR1-ky
Previous Names
None
Target
Sequence
5' - AGAGGAGATTGTGAAACCCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
yo1 ky
Expression
Gene expression in Wild Types + CRISPR1-ky
No data available
Phenotype
Phenotype resulting from CRISPR1-ky
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ky
Citations