Community Action Needed: Please respond to the NIH RFI
Genomic Feature

yo1

ID
ZDB-ALT-190109-1
Name
yo1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Pownall Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 13: 13754137 - 13754141 (GRCz11) (1) Details
Nucleotide change
TCTCC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted in Exon 2 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TCTTCTGGGCATCAAATTCTTCCTTCTCCCTCAACTGAAAAGCACATATTCATTACTAAAGCCCTGTTCACACCAAAGATTTTAACTACAACTATAAAATTACTATTTAACTATAATGAAAATGGCACTGAGTAATATTGTTGGATTAAACTGATTCAGCTGATGAAAGATAAAAATATTAAGAGACTTTAAATAGTGGATGACAAACTGTAGTGTTTCTAAAAGTAAATAACAAAATAAAAAGTGTTATCATCTGCTGGTGTAGATGCTAATATACTAGTTATGATTAAGGTCCTCAATCATGGTGTTAGCACAGAGTGCACAATGTTTGTTGTCAATTACCTCTCTTCCTTTCTGCATGGAGAATGCATCTACTTTGTTGAAAACATCAGTCCTTGTGAAGAGCACTTTTCTGGGTTTCCTCTGAGAGGTGGAGACTGCAGGTAGATAAGGTCTCCCGCTCTGCATGCCAGGGCTGGCAACTGAGGGGGGTTTCACAA
TCTCC/- TCTTGGCTCTTTTTCACAGTGCTTCTCTTTCTTACGCTCACTGATTTTGCCGCACTCTCAGCGGACAGTTGCCGCTTTGTGCTCGGTCGCTGTTCCTCGCATAACTTCCCATCATAGTTCTCACACAGAGCCTTATGTGAAGCCGCATTTTCTTGTATCGATTCGTTTTTTAAGGGCTTCGGGTCATGCCGCTCCACTGACTGTGAACTTCCTTGGTGGCTCTTAATAGTCAGACAGACTTTGACATCCATATCAGTTTTTTGGCTGCCAGATACATTTTGAAGTTTCGATTTCAGCACACCGTTTTCAATTTTCAAATCAAAATGTTGTTTCTTCGTGTCATTGTTTGAGCCTGCTTCTTCTGATTGGTGGCTGTTTTCTGTTTGTTGAGCAGTTTCAACTTCATCAGTGCAGATGAAAGTAAAAAAAAAATAATTTATGACATTATTTTAATTGGAGAGTTGATCCAATAACTGATCTTATTTTATCTACCCTCGGCC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations