CRISPR

CRISPR1-pam

ID
ZDB-CRISPR-180802-1
Name
CRISPR1-pam
Previous Names
None
Target
Sequence
5' - TAGTCACAGTATCCAAAACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mbg10 pam
mbg5 pam
mbg9 pam
Expression
Gene expression in Wild Types + CRISPR1-pam
No data available
Phenotype
Phenotype resulting from CRISPR1-pam
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pam
Phenotype Fish Conditions Figures
ciliary basal body-plasma membrane docking disrupted, abnormal pammbg5/mbg5 standard conditions Fig. S6 with image from Kumar et al., 2018
pronephros ciliary basal body mislocalised, abnormal pammbg5/mbg5 standard conditions Fig. S6 with image from Kumar et al., 2018
brush border epithelial cell microvillus absent, abnormal pammbg5/mbg5 standard conditions Fig. 5 with image from Kumar et al., 2018
brain hydrocephalic, abnormal pammbg5/mbg5 standard conditions Fig. 3 with image from Kumar et al., 2018
whole organism dead, abnormal pammbg5/mbg5 standard conditions Fig. 3 with image from Kumar et al., 2018
pronephros axoneme morphology, abnormal pammbg5/mbg5 standard conditions Fig. 5 with image from Kumar et al., 2018
pronephros microvillus decreased amount, abnormal pammbg5/mbg5 standard conditions Fig. 5 with imageFig. S5 with image from Kumar et al., 2018
gut edematous, abnormal pammbg5/mbg5 standard conditions Fig. 3 with image from Kumar et al., 2018
pronephros ciliary membrane absent, abnormal pammbg5/mbg5 standard conditions Fig. 5 with image from Kumar et al., 2018
eye decreased size, abnormal pammbg5/mbg5 standard conditions Fig. 3 with image from Kumar et al., 2018
pronephros cilium decreased amount, abnormal pammbg5/mbg5 standard conditions Fig. 5 with imageFig. S5 with image from Kumar et al., 2018
peptidylglycine monooxygenase activity disrupted, abnormal pammbg5/mbg5 standard conditions Fig. 1 with image from Kumar et al., 2018
whole organism decreased life span, abnormal pammbg5/mbg5 standard conditions Fig. 3 with image from Kumar et al., 2018
pronephric tubule cystic, abnormal pammbg5/mbg5 standard conditions Fig. S4 with image from Kumar et al., 2018
pronephros morphology, abnormal pammbg5/mbg5 standard conditions Fig. 5 with image from Kumar et al., 2018
gut cystic, abnormal pammbg5/mbg5 standard conditions Fig. 3 with image from Kumar et al., 2018
heart edematous, abnormal pammbg5/mbg5 standard conditions Fig. 3 with image from Kumar et al., 2018
gut edematous, abnormal pammbg9/+; pammbg5/+ standard conditions Fig. 4 with image from Kumar et al., 2018
heart edematous, abnormal pammbg9/+; pammbg5/+ standard conditions Fig. 4 with image from Kumar et al., 2018
gut edematous, abnormal pammbg10/+; pammbg5/+ standard conditions Fig. 4 with image from Kumar et al., 2018
heart edematous, abnormal pammbg10/+; pammbg5/+ standard conditions Fig. 4 with image from Kumar et al., 2018
Citations