CRISPR

CRISPR6-rela

ID
ZDB-CRISPR-180517-1
Name
CRISPR6-rela
Previous Names
None
Target
Sequence
5' - GGCTGATGTGCACCGGCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb651 rela
ihb652 rela
zko3266A rela
zko3266B rela
Expression
Gene expression in Wild Types + CRISPR6-rela
No data available
Phenotype
Phenotype resulting from CRISPR6-rela
No data available
Phenotype of all Fish created by or utilizing CRISPR6-rela
Phenotype Fish Conditions Figures
kidney cxcl8b.1 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
whole organism mxc expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
liver cxcl8a expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
whole organism cxcl8b.1 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
liver ifnphi1 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
whole organism ventral region hemorrhagic, exacerbated relaihb651/ihb651 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 5 from Ouyang et al., 2020
kidney necrotic, exacerbated relaihb651/ihb651 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 5 from Ouyang et al., 2020
liver il1b expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
whole organism tnfa expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
liver il10 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
whole organism tnfb expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
pleuroperitoneal region swollen, exacerbated relaihb651/ihb651 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 5 from Ouyang et al., 2020
whole organism il1b expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
whole organism pkz expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
whole organism il6 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
liver il6 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
liver mxc expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
kidney tnfa expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
liver cxcl8b.1 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
kidney il1b expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
kidney mxc expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
kidney il6 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
whole organism cxcl8a expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
kidney tnfb expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
liver pkz expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
liver tnfb expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
whole organism il10 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
defense response to virus disrupted, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 3 from Ouyang et al., 2020
liver tnfa expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 6 from Ouyang et al., 2020
whole organism viability, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 3 from Ouyang et al., 2020
liver necrotic, exacerbated relaihb651/ihb651 (AB) viral treatment by injection: Sprivivirus cyprinus Fig. 5 from Ouyang et al., 2020
whole organism ifnphi1 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 4 from Ouyang et al., 2020
kidney ifnphi1 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
kidney cxcl8a expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
kidney il10 expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
kidney pkz expression decreased amount, abnormal relaihb651/ihb651 (AB) viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 from Ouyang et al., 2020
Citations