Community Action Needed: Please respond to the NIH RFI
CRISPR

CRISPR2-cxcr4a

ID
ZDB-CRISPR-180412-2
Name
CRISPR2-cxcr4a
Previous Names
None
Target
Sequence
5' - GTACCGTCTGCACCTCTCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
a169 cxcr4a
Expression
Gene expression in Wild Types + CRISPR2-cxcr4a
No data available
Phenotype
Phenotype resulting from CRISPR2-cxcr4a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-cxcr4a
Phenotype Fish Conditions Figures
endoderm cell migration involved in gastrulation process quality, abnormal cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm sox17 expression decreased distribution, abnormal cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm sox17 expression spatial pattern, abnormal cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm sox17 expression decreased distribution, abnormal apelaa141/a141 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm cell migration involved in gastrulation process quality, abnormal apelaa141/a141 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
blastoderm fn1a expression spatial pattern, abnormal apelaa141/a141 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm sox17 expression spatial pattern, abnormal apelaa141/a141 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
mesodermal cell migration decreased process quality, abnormal apelaa141/a141 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm cell migration involved in gastrulation process quality, abnormal apelaa142/a142 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm sox17 expression decreased distribution, abnormal apelaa142/a142 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
blastoderm fn1a expression spatial pattern, abnormal apelaa142/a142 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
endoderm sox17 expression spatial pattern, abnormal apelaa142/a142 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
mesodermal cell migration decreased process quality, abnormal apelaa142/a142 ; cxcr4aa169/a169 standard conditions Fig. 7 with image from Norris et al., 2017
Citations