CRISPR

CRISPR1-irf6

ID

ZDB-CRISPR-180320-3

Name

CRISPR1-irf6

Previous Names

None

Target

irf6 (1)

Sequence

5' - CCGCGGTAAAGAGGTGTGTCCCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf2064	irf6

Expression

Gene expression in Wild Types + CRISPR1-irf6

No data available

Phenotype

Phenotype resulting from CRISPR1-irf6

No data available

Phenotype of all Fish created by or utilizing CRISPR1-irf6

Phenotype	Fish	Conditions	Figures
whole organism dead, abnormal	irf6^{zf2064/zf2064}	standard conditions	Fig. 3 from Zhang et al., 2020
whole organism decreased life span, abnormal	irf6^{zf2064/zf2064}	standard conditions	Fig. 3 from Zhang et al., 2020
periderm ruptured, abnormal	irf6^{zf2064/zf2064}	standard conditions	Fig. 3 from Zhang et al., 2020
whole organism wnt11 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism esrp1 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism fgf17 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism fgf24 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism fzd5 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism hey1 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism dact2 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism fgf8a expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism gata3 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism frzb expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
whole organism rspo3 expression decreased amount, abnormal	irf6^{zf2064/zf2064} (TU)	standard conditions	Fig. 1. from Carroll et al., 2020
epiboly involved in gastrulation with mouth forming second decreased occurrence, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 1 from Li et al., 2017
periderm broken, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 1 from Li et al., 2017
whole organism grhl3 expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
whole organism cebpb expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
whole organism hey1 expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
whole organism krt4 expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
embryonic structure detached from yolk, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 1 from Li et al., 2017
whole organism tfap2a expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
whole organism klf2a expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
whole organism cldne expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
whole organism gata3 expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017
whole organism grhl1 expression decreased amount, abnormal	irf6^zf2064 (TU)	standard conditions	Fig. 3 from Li et al., 2017

Citations