header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180319-5
CRISPR Name: CRISPR1-lcp1
Target: lcp1 (1)
Source:
Target Sequence:
5' - GAACCCGGTACCCCGGCAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The published CRISPR sequence contained a typo (a "C" was left out). The authors were contacted and provided this updated sequence.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-lcp1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-lcp1
Genomic Feature Affected Genomic Regions    
ud1 lcp1    
ud2 lcp1    
ud3 lcp1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-lcp1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-lcp1
No data available

Phenotype of all Fish created by or utilizing CRISPR1-lcp1
Genome Resources:
CITATIONS (3)