CRISPR

CRISPR1-kdm6ba

ID
ZDB-CRISPR-180307-4
Name
CRISPR1-kdm6ba
Previous Names
None
Target
Sequence
5' - GCTTAGCATATTCCCACTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
b1308 kdm6ba
zko2043A kdm6ba
Expression
Gene expression in Wild Types + CRISPR1-kdm6ba
No data available
Phenotype
Phenotype resulting from CRISPR1-kdm6ba
No data available
Phenotype of all Fish created by or utilizing CRISPR1-kdm6ba
Phenotype Fish Conditions Figures
whole organism kdm6ba expression decreased amount, abnormal kdm6bab1308/b1308 standard conditions Fig. 2 with image from Akerberg et al., 2017
swim bladder uninflated, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
basihyal cartilage chondrocyte decreased amount, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
heart trabecula formation decreased process quality, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 4 with image from Akerberg et al., 2017
cardiac ventricle decreased size, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 4 with image from Akerberg et al., 2017
cardiac ventricle malformed, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. Movie S1 from Akerberg et al., 2017
mouth open, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
pericardium edematous, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
cardiac ventricle shape, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 4 with image from Akerberg et al., 2017
whole organism viability, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
basihyal cartilage decreased length, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
whole organism decreased life span, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
head swollen, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307 standard conditions Fig. 3 with image from Akerberg et al., 2017
cardiac ventricle shape, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307; hsc4Tg standard conditions Fig. 4 with image from Akerberg et al., 2017
cardiac ventricle decreased size, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307; hsc4Tg standard conditions Fig. 4 with image from Akerberg et al., 2017
myocardium cell population proliferation decreased process quality, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307; s843Tg standard conditions Fig. 5 with image from Akerberg et al., 2017
endocardium pcna expression decreased amount, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307; s843Tg standard conditions Fig. 5 with image from Akerberg et al., 2017
myocardium pcna expression decreased amount, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307; s843Tg standard conditions Fig. 5 with image from Akerberg et al., 2017
endocardium cell population proliferation decreased process quality, abnormal kdm6bab1308/b1308; kdm6bbb1307/b1307; s843Tg standard conditions Fig. 5 with image from Akerberg et al., 2017
Citations