header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180208-1
CRISPR Name: CRISPR1-otx2b
Target: otx2b (1)
Source:
Target Sequence:
5' - GGAACCCGGCTAATTGTCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This CRISPR was designed to target approximately 500 base pairs upstream of the ATG start site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-otx2b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-otx2b
Genomic Feature Affected Genomic Regions    
tud40Tg    
tud41Tg    
tud44a otx2b    
tud44Tg otx2b    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-otx2b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-otx2b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-otx2b
OTHER CRISPR1-otx2b CRISPR PAGESNo links to external sites
CITATIONS (2)