CRISPR

CRISPR1-esr2b

ID
ZDB-CRISPR-171026-4
Name
CRISPR1-esr2b
Previous Names
None
Target
Sequence
5' - CCGATCGAGGGGCCTCGCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umo13 esr2b
Expression
Gene expression in Wild Types + CRISPR1-esr2b
No data available
Phenotype
Phenotype resulting from CRISPR1-esr2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-esr2b
Phenotype Fish Conditions Figures
testis esr2a expression decreased amount, abnormal esr2bumo13/umo13 standard conditions Fig. 10 from Lu et al., 2017
male organism ratio female organism, abnormal esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
Fig. 2 from Lu et al., 2017
sex determination process quality, abnormal esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
female organism decreased amount, abnormal esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
Fig. 2 from Lu et al., 2017
male organism increased amount, abnormal esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
Fig. 2 from Lu et al., 2017
male organism ratio female organism, abnormal esr1umo10/umo10; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
sex determination process quality, abnormal esr1umo10/umo10; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
female organism decreased amount, abnormal esr1umo10/umo10; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
male organism increased amount, abnormal esr1umo10/umo10; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
ovarian follicle stromal cell hyperplastic, abnormal esr2aumo11/umo11; esr2bumo13/umo13 standard conditions Fig. 5Fig. 6 from Lu et al., 2017
ovarian follicle degenerate, abnormal esr2aumo11/umo11; esr2bumo13/umo13 standard conditions Fig. 6 from Lu et al., 2017
male organism ratio female organism, abnormal esr2aumo11/umo11; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
sex determination process quality, abnormal esr2aumo11/umo11; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
male organism increased amount, abnormal esr2aumo11/umo11; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
female organism decreased amount, abnormal esr2aumo11/umo11; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
female organism absent, abnormal esr2aumo11/umo11; esr2bumo13/umo13 standard conditions Fig. 7 from Lu et al., 2017
ovarian follicle stromal cell hyperplastic, abnormal esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 5 from Lu et al., 2017
male organism ratio female organism, abnormal esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
sex determination process quality, abnormal esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
female organism absent, abnormal esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 6Fig. 7 from Lu et al., 2017
male organism increased amount, abnormal esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
female organism decreased amount, abnormal esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 2 from Lu et al., 2017
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination decreased occurrence, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination absent process, abnormal cyp19a1aumo5/umo5; esr1umo10/+; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination occurrence, ameliorated cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/+; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development normal occurrence, ameliorated cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/+; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination absent process, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/+ chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
regulation of female gonad development disrupted, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
female sex determination absent process, abnormal cyp19a1aumo5/umo5; esr1umo10/umo10; esr2aumo11/umo11; esr2bumo13/umo13 chemical treatment by environment: bisphenol A Fig. 6 from Song et al., 2019
male organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/+; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
ovarian follicle degenerate, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/+; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism ratio male organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/+; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/+; esr2aumo12/+; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/+ standard conditions Fig. 4 with image from Wu et al., 2020
male organism ratio female organism, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
ovarian follicle degenerate, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
male organism decreased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
female organism increased amount, abnormal cyp19a1aumo5/umo5; dmrt1umo15/umo15; esr1umo10/umo10; esr2aumo12/umo12; esr2bumo13/umo13 standard conditions Fig. 4 with image from Wu et al., 2020
Citations