CRISPR

CRISPR1-hif1aa

ID

ZDB-CRISPR-171002-7

Name

CRISPR1-hif1aa

Previous Names

None

Target

hif1aa (1)

Sequence

5' - AGCCTCAATGTTCGCCGGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
bns89	hif1aa

Expression

Gene expression in Wild Types + CRISPR1-hif1aa

No data available

Phenotype

Phenotype resulting from CRISPR1-hif1aa

No data available

Phenotype of all Fish created by or utilizing CRISPR1-hif1aa

Phenotype	Fish	Conditions	Figures
respiratory gaseous exchange by respiratory system increased frequency, abnormal	hif1aa^bns89/bns89	hypoxia	Fig. 1 from Mandic et al., 2018
whole organism hif1aa expression decreased amount, abnormal	hif1aa^bns89/bns89	standard conditions	Fig. 1 from Gerri et al., 2017
respiratory gaseous exchange by respiratory system frequency, abnormal	hif1aa^bns89/bns89	hypoxia	Fig. 2, Fig. 6 from Mandic et al., 2018
response to hypoxia process quality, abnormal	hif1aa^bns89/bns89	hypoxia	Fig. 1, Fig. 2, Fig. 6 from Mandic et al., 2018
whole organism myb expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 4 from Gerri et al., 2018
blood vessel endothelial cell cell population proliferation decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	cryoablation: heart	Fig. 3 from Marín-Juez et al., 2019
trunk has fewer parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	control	Fig. 3 from Gerri et al., 2017
ventral wall of dorsal aorta macrophage migration decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	control	Fig. 3 from Gerri et al., 2017
trunk has fewer parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 3 from Gerri et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 1, Fig. 4 from Gerri et al., 2018
whole organism gata2b expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	control	Fig. 5 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 1, Fig. 4 from Gerri et al., 2018
whole organism runx1 expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 4 from Gerri et al., 2018
whole organism hif1aa expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 2 from Gerri et al., 2017
regenerating tissue cardiac ventricle cxcl12b expression amount, ameliorated	hif1ab^bns90/bns90; hif1aa^bns89/bns89	cryoablation: heart	Fig. 3 from Marín-Juez et al., 2019
trunk has fewer parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	chemical treatment by environment: dimethyloxalylglycine	Fig. 3 from Gerri et al., 2017
ventral wall of dorsal aorta anatomical region has extra parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	control	Fig. 3 from Gerri et al., 2017
respiratory gaseous exchange by respiratory system increased frequency, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	control	Fig. 5 from Mandic et al., 2018
ventral wall of dorsal aorta anatomical region has extra parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 3 from Gerri et al., 2017
whole organism notch1b expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	control	Fig. 5 from Gerri et al., 2018
ventral wall of dorsal aorta macrophage migration decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	chemical treatment by environment: dimethyloxalylglycine	Fig. 3 from Gerri et al., 2017
ventral wall of dorsal aorta anatomical region has extra parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	chemical treatment by environment: dimethyloxalylglycine	Fig. 3 from Gerri et al., 2017
ventral wall of dorsal aorta runx1 expression amount, ameliorated	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 4 from Gerri et al., 2018
regenerating tissue cell population proliferation decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	cryoablation: heart	Fig. 3 from Marín-Juez et al., 2019
respiratory gaseous exchange by respiratory system increased frequency, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 1 from Mandic et al., 2018
whole organism notch1a expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	control	Fig. 5 from Gerri et al., 2018
ventral wall of dorsal aorta macrophage migration decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 3 from Gerri et al., 2017
hematopoietic system runx1 expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 1 from Gerri et al., 2018
respiratory gaseous exchange by respiratory system frequency, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 1, Fig. 2, Fig. 6 from Mandic et al., 2018
hematopoietic system myb expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 1 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression amount, ameliorated	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 4 from Gerri et al., 2018
whole organism hif1ab expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	standard conditions	Fig. 2 from Gerri et al., 2017
response to hypoxia process quality, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89	hypoxia	Fig. 1, Fig. 2, Fig. 6 from Mandic et al., 2018
dorsal longitudinal anastomotic vessel absent, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	control	Fig. 2 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel absent, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	hypoxia	Fig. 2 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel absent, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel malformed, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	hypoxia	Fig. 2 from Gerri et al., 2017
intersegmental vessel broken, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Gerri et al., 2017
intersegmental vessel detached from dorsal longitudinal anastomotic vessel, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel blood vessel development process quality, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	control	Fig. 2 from Gerri et al., 2017
intersegmental vessel closed, exacerbated	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	hypoxia	Fig. 2 from Gerri et al., 2017
intersegmental vessel closed, exacerbated	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel blood vessel development process quality, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Gerri et al., 2017
intersegmental vessel detached from dorsal longitudinal anastomotic vessel, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	hypoxia	Fig. 2 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel blood vessel development process quality, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	hypoxia	Fig. 2 from Gerri et al., 2017
intersegmental vessel closed, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	control	Fig. 2 from Gerri et al., 2017
intersegmental vessel broken, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	hypoxia	Fig. 2 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel malformed, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg	chemical treatment by environment: dimethyloxalylglycine	Fig. 2 from Gerri et al., 2017
macrophage mCherry expression absent, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg; ump2Tg	standard conditions	Fig. 6 from Gerri et al., 2017
ventral wall of dorsal aorta macrophage migration decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg; ump2Tg	standard conditions	Fig. 3 from Gerri et al., 2017
trunk has fewer parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg; ump2Tg	standard conditions	Fig. 3 from Gerri et al., 2017
intersegmental vessel regeneration decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg; ump2Tg	chemical treatment by environment: dimethyloxalylglycine	Fig. 7 from Gerri et al., 2017
ventral wall of dorsal aorta anatomical region has extra parts of type macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg; ump2Tg	standard conditions	Fig. 3 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel malformed, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg; ump2Tg	standard conditions	Fig. 6 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel angiogenic sprout dissociated from macrophage, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; s843Tg; ump2Tg	standard conditions	Fig. 6 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; c264Tg; gl24Tg; s843Tg	chemical ablation: macrophage, chemical treatment by environment: metronidazole	Fig. 4 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; c264Tg; gl24Tg; s843Tg	control	Fig. 4 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel malformed, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; c264Tg; gl24Tg; s843Tg	chemical ablation: macrophage, chemical treatment by environment: metronidazole	Fig. 4 from Gerri et al., 2017
dorsal longitudinal anastomotic vessel malformed, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; c264Tg; gl24Tg; s843Tg	control	Fig. 4 from Gerri et al., 2017
intersegmental vessel broken, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; c264Tg; gl24Tg; s843Tg	chemical ablation: macrophage, chemical treatment by environment: metronidazole	Fig. 4 from Gerri et al., 2017
intersegmental vessel broken, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89; c264Tg; gl24Tg; s843Tg	control	Fig. 4 from Gerri et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89 + MO1-epas1a + MO3-epas1b	hypoxia	Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89 + MO1-epas1a + MO3-epas1b	control	Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89 + MO1-epas1a + MO3-epas1b	hypoxia	Fig. 4 from Gerri et al., 2018
whole organism myb expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89 + MO1-epas1a + MO3-epas1b	standard conditions	Fig. 4 from Gerri et al., 2018
whole organism runx1 expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89 + MO1-epas1a + MO3-epas1b	standard conditions	Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	hif1ab^bns90/bns90; hif1aa^bns89/bns89 + MO1-epas1a + MO3-epas1b	control	Fig. 4 from Gerri et al., 2018

Citations