CRISPR

CRISPR2-slc30a10

ID
ZDB-CRISPR-170926-1
Name
CRISPR2-slc30a10
Previous Names
None
Target
Sequence
5' - GCTCTGCTTCTCCATCAGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zju11 slc30a10
zju12 slc30a10
Expression
Gene expression in Wild Types + CRISPR2-slc30a10
No data available
Phenotype
Phenotype resulting from CRISPR2-slc30a10
No data available
Phenotype of all Fish created by or utilizing CRISPR2-slc30a10
Phenotype Fish Conditions Figures
liver color, ameliorated slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride, chemical treatment by environment: EDTA monocalcium diisodium salt Fig. 4 with image from Xia et al., 2017
whole organism ab1-gad labeling increased amount, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
locomotory behavior process quality, ameliorated slc30a10zju12/zju12 chemical treatment by environment: Ferrous fumarate, chemical treatment by environment: manganese(II) chloride Fig. S3 with image from Xia et al., 2017
whole organism decreased size, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
whole organism decreased life span, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
whole organism balance, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
liver col1a1a expression increased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 3 with image from Xia et al., 2017
locomotory behavior process quality, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image,  Fig. 4 with image,  Fig. S3 with image from Xia et al., 2017
brain th expression decreased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
brain slc6a3 expression decreased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
whole organism ab1-gad labeling increased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
liver fatty, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 3 with image from Xia et al., 2017
whole organism decreased mobility, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image,  Fig. 4 with image from Xia et al., 2017
whole organism manganese(2+) increased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
locomotory behavior process quality, ameliorated slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride, chemical treatment by environment: EDTA monocalcium diisodium salt Fig. 4 with image from Xia et al., 2017
whole organism slc32a1 expression decreased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
liver color, ameliorated slc30a10zju12/zju12 chemical treatment by environment: Ferrous fumarate, chemical treatment by environment: manganese(II) chloride Fig. S3 with image from Xia et al., 2017
liver manganese(2+) increased amount, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
liver ccn2a expression increased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 3 with image from Xia et al., 2017
liver color, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 4 with image,  Fig. S3 with image from Xia et al., 2017
locomotory behavior process quality, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image,  Fig. S2Movie from Xia et al., 2017
whole organism decreased thickness, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
liver atp2c1 expression increased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 5 from Xia et al., 2017
whole organism gabbr1b expression decreased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
whole organism decreased fertility, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
liver fatty, abnormal slc30a10zju12/zju12 standard conditions Fig. 3 with image from Xia et al., 2017
whole organism manganese atom increased amount, abnormal slc30a10zju12/zju12 standard conditions Fig. 1 with image from Xia et al., 2017
whole organism decreased mobility, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
gut color, abnormal slc30a10zju12/zju12 chemical treatment by environment: Ferrous fumarate, chemical treatment by environment: manganese(II) chloride Fig. S3 with image from Xia et al., 2017
whole organism manganese atom decreased amount, abnormal slc30a10zju12/zju12 standard conditions Fig. 1 with image from Xia et al., 2017
whole organism manganese(2+) increased amount, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
whole organism gabbr1a expression decreased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
brain apoptotic process increased occurrence, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 2 with image from Xia et al., 2017
brain manganese(2+) increased amount, abnormal slc30a10zju12/zju12 standard conditions Fig. 2 with image from Xia et al., 2017
liver damage, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 3 with image from Xia et al., 2017
whole organism atp2c1 expression increased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 5 from Xia et al., 2017
brain atp2c1 expression increased amount, abnormal slc30a10zju12/zju12 chemical treatment by environment: manganese(II) chloride Fig. 5 from Xia et al., 2017
whole organism slc30a10 expression increased amount, abnormal slc30a10zju12/+ chemical treatment by environment: manganese(II) chloride Fig. 1 with image from Xia et al., 2017
nucleate erythrocyte increased amount, abnormal slc30a10zju12/zju12; cz3325Tg standard conditions Fig. 4 with image from Xia et al., 2017
whole organism decreased life span, abnormal slc30a10zju12/zju12 + MO1-atp2c1 chemical treatment by environment: manganese(II) chloride Fig. 5 from Xia et al., 2017
locomotory behavior process quality, abnormal slc30a10zju12/zju12 + MO1-atp2c1 chemical treatment by environment: manganese(II) chloride Fig. 5 from Xia et al., 2017
liver color, abnormal slc30a10zju12/zju12 + MO1-atp2c1 chemical treatment by environment: manganese(II) chloride Fig. 5 from Xia et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.