CRISPR

CRISPR3-chd7

ID
ZDB-CRISPR-170801-1
Name
CRISPR3-chd7
Previous Names
None
Target
Sequence
5' - GGGGACTGTGGCTACCCTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hsi3 chd7
Expression
Gene expression in Wild Types + CRISPR3-chd7
No data available
Phenotype
Phenotype resulting from CRISPR3-chd7
No data available
Phenotype of all Fish created by or utilizing CRISPR3-chd7
Phenotype Fish Conditions Figures
retina chd7 expression absent, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 from Krueger et al., 2022
swim bladder malformed, abnormal chd7hsi3/hsi3 standard conditions Fig. 3 from Krueger et al., 2022
retinal cone cell cone photoreceptor outer segment decreased length, abnormal chd7hsi3/hsi3 standard conditions Fig. 6 from Krueger et al., 2022
melanocyte spatial pattern, abnormal chd7hsi3/hsi3 standard conditions Fig. 1 from Cloney et al., 2018
heart increased size, abnormal chd7hsi3/hsi3 standard conditions Fig. 1 from Cloney et al., 2018
cranial nerve X neuron projection decreased amount, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 from Cloney et al., 2018
swim bladder uninflated, abnormal chd7hsi3/hsi3 standard conditions Fig. 1 from Cloney et al., 2018
eye decreased size, abnormal chd7hsi3/hsi3 standard conditions Fig. 3Fig. 4 from Krueger et al., 2022
Fig. 4 with image from Prykhozhij et al., 2017
swim bladder uninflated, abnormal chd7hsi3/hsi3 standard conditions Fig. 3 from Krueger et al., 2022
Fig. 4 with image from Prykhozhij et al., 2017
retinal rod cell rod photoreceptor outer segment decreased length, abnormal chd7hsi3/hsi3 standard conditions Fig. 6 from Krueger et al., 2022
retinal cone cell development decreased process quality, abnormal chd7hsi3/hsi3 standard conditions Fig. 5 from Krueger et al., 2022
whole organism decreased life span, abnormal chd7hsi3/hsi3 standard conditions Fig. 3 from Krueger et al., 2022
intestinal motility disrupted, abnormal chd7hsi3/hsi3 standard conditions Fig. 7 from Cloney et al., 2018
retinal rod cell photoreceptor cell outer segment organization decreased process quality, abnormal chd7hsi3/hsi3 standard conditions Fig. 6 from Krueger et al., 2022
heart increased size, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 with image from Prykhozhij et al., 2017
retinal cone cell photoreceptor cell outer segment organization decreased process quality, abnormal chd7hsi3/hsi3 standard conditions Fig. 6 from Krueger et al., 2022
enteric neuron neuron projection decreased amount, abnormal chd7hsi3/hsi3 standard conditions Fig. 4 from Cloney et al., 2018
retinal photoreceptor layer has fewer parts of type retinal cone cell, abnormal chd7hsi3/hsi3 standard conditions Fig. 5 from Krueger et al., 2022
heart edematous, abnormal chd7hsi3/hsi3 standard conditions Fig. 3 from Krueger et al., 2022
Fig. 4 with image from Prykhozhij et al., 2017
head phox2ba expression decreased distribution, abnormal chd7hsi3/hsi3 (TU) standard conditions Figure 1 with image from MacLean et al., 2023
opercle movement quality, abnormal chd7hsi3/hsi3 (TU) chemical treatment by environment: tricaine Figure 4 with image from MacLean et al., 2023
thigmotaxis increased process quality, abnormal chd7hsi3/hsi3 (TU) chemical treatment by environment: tricaine Figure 3 with image from MacLean et al., 2023
opercle movement quality, abnormal chd7hsi3/hsi3 (TU) chemical treatment by environment: tricaine Figure 4 with image from MacLean et al., 2023
heart contraction decreased rate of continuous process, abnormal chd7hsi3/hsi3 (TU) chemical treatment by environment: tricaine Figure 2 with image from MacLean et al., 2023
enteric neuron neuron projection decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Cloney et al., 2018
retinal outer nuclear layer chd7 expression decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Krueger et al., 2022
retinal rod cell rod photoreceptor outer segment decreased length, abnormal chd7hsi3/+ standard conditions Fig. 6 from Krueger et al., 2022
ciliary marginal zone chd7 expression decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Krueger et al., 2022
swim bladder uninflated, abnormal chd7hsi3/+ standard conditions Fig. 1 from Cloney et al., 2018
melanocyte spatial pattern, abnormal chd7hsi3/+ standard conditions Fig. 1 from Cloney et al., 2018
retinal rod cell photoreceptor cell outer segment organization decreased process quality, abnormal chd7hsi3/+ standard conditions Fig. 6 from Krueger et al., 2022
cranial nerve X neuron projection decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Cloney et al., 2018
retinal cone cell cone photoreceptor outer segment decreased length, abnormal chd7hsi3/+ standard conditions Fig. 6 from Krueger et al., 2022
retinal cone cell development decreased process quality, abnormal chd7hsi3/+ standard conditions Fig. 5 from Krueger et al., 2022
intestinal motility disrupted, abnormal chd7hsi3/+ standard conditions Fig. 7 from Cloney et al., 2018
retinal cone cell photoreceptor cell outer segment organization decreased process quality, abnormal chd7hsi3/+ standard conditions Fig. 6 from Krueger et al., 2022
heart increased size, abnormal chd7hsi3/+ standard conditions Fig. 1 from Cloney et al., 2018
retinal ganglion cell layer chd7 expression decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Krueger et al., 2022
eye decreased size, abnormal chd7hsi3/+ standard conditions Fig. 4 from Krueger et al., 2022
retinal inner nuclear layer chd7 expression decreased amount, abnormal chd7hsi3/+ standard conditions Fig. 4 from Krueger et al., 2022
retinal photoreceptor layer has fewer parts of type retinal cone cell, abnormal chd7hsi3/+ standard conditions Fig. 5 from Krueger et al., 2022
Citations