ZFIN ID: ZDB-CRISPR-170522-1
CRISPR Name: CRISPR1-ids
Target: ids (1)
Source:
Target Sequence:
5' - GTTAGGAAAGACACTCTACTAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-ids No data available
GENOMIC FEATURES CREATED WITH CRISPR1-ids
Genomic Feature Affected Genomic Regions    
ia200 ids    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-ids No data available
PHENOTYPE
Phenotype resulting from CRISPR1-ids
No data available

Phenotype of all Fish created by or utilizing CRISPR1-ids
Phenotype Fish Conditions Figures
opercle etv4 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
opercle dusp6 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
neurocranium etv4 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
axis curved dorsal, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
fin mapk3 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
vertebral column kinked, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
spinal cord curved dorsal, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
opercle bglap expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
opercle col2a1a expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
spinal cord kinked, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
neurocranium dusp6 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
fin etv4 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
neurocranium mapk3 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
fin dusp6 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
axis kinked, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
fin sp7 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
fin col10a1a expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
opercle sp7 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
opercle mapk3 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 3 from Bellesso et al., 2018
vertebral column curved dorsal, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
neurocranium sp7 expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
fin col2a1a expression increased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
neurocranium bglap expression decreased amount, abnormal idsia200/ia200 standard conditions Fig. 4 from Bellesso et al., 2018
liver increased size, abnormal idsia200/ia200 standard conditions Fig. 2 from Bellesso et al., 2018
whole organism d2EGFP expression decreased amount, abnormal idsia200/ia200 ; pt6Tg standard conditions Fig. 3 from Bellesso et al., 2018
whole organism mapk3 expression decreased amount, abnormal idsia200/ia200 ; pt6Tg standard conditions Fig. 3 from Bellesso et al., 2018
whole organism etv4 expression decreased amount, abnormal idsia200/ia200 ; pt6Tg standard conditions Fig. 3 from Bellesso et al., 2018
whole organism etv5b expression decreased amount, abnormal idsia200/ia200 ; pt6Tg standard conditions Fig. 3 from Bellesso et al., 2018
Genome Resources:
CITATIONS (2)