Genomic Feature

ia200

ID
ZDB-ALT-170522-1
Name
ia200
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Moro Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 14: 20891328 - 20891332 (GRCz11) (1) Details
Nucleotide change
CTACT/-
Variant Notes
The mutant fish harbors a 5 bp deletion (sequence CTACT) from nucleotide 241 to  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted from position 241 to 245 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AATGTCTTTAATTTACTAAATTTAAGGTATTTGGTGAGGAAAAAACACAGAAAATGTTTTTTTTTTTTCACTTTTATCAAATAAATAAAGATTAAAGAAAATTAAAGAGGTTGTTGACTTTGAGTTTTTTTTTTTTTTTTTCAAAGATATTTTGAAGAATGTTGGATTTAACGTCTATTTAGTCAGTGGGTTTTAATTTATGGGTGAACTGTCTGCTGAACAAATCACAGATTCTTGATTTCATTACACTTTACAAATTATTATGACTTTTTTAGAATTAGAATTTAGCCTCAATAATGAGATACAGTTTTTTCACGCATCGTGAAAATTATGCACGCGTCATACCAGGATGGAAGACTTTGCCCACTGATAAAGTGGTGTATCCATTAGACTTGAAGTATTGAGGTAGTGTGGTGTAGTTTCCAGCATGAACTCTCCAGTATGAGTTGAAATCGTAGAGTTTTGTGGTGTCTGGTCTTCGACTTGTTAGGAAAGACACT
CTACT/- AGGTCCACAAACAGCTTGCTTTGAAAGAACACATTGTAATATACACTTAACATAAGTATAGATGTATGCATTATGTATCCATATGCATATTATTCATGTTTTCCATGAGCATTAATACAACATACCTGGGCATATGCGTTATGAAACACTACGCTCAAAGATGCAAGCTGATCGATGTTCGGTGATTTGACCACTGGATCAGAATAACAGCCTAAAGATGGTCTCAGATCGTCAGCAATTAAATACAAAACGTTGAAATCTTTGCTTTTTGCTGCAAAAACATCTCGCCCCAAAAGGTGAAAAATAAAAACAAACCACCAACACGTAAATACGAACATTACATTCATTGTGTTGCGCGGTTTCGTTTCAGATACTTCTTTCACATGTTTGTTTTATGCTGTTTAGAGAATTCCAGTGTTTTGCTTCCTGGTTTTCAAAGGCTTGCTATGATTGGAGGGGGTGGTCTTAAAGGGACAGTACACAGTTTCGCTTCAATAAGG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations