header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170504-1
CRISPR Name: CRISPR1-mymk
Target: mymk (1)
Previous Name: CRISPR1-tmem8c

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GTTTGTGCCTGCAGCCAGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-mymk No data available
GENOMIC FEATURES CREATED WITH CRISPR1-mymk
Genomic Feature Affected Genomic Regions    
sq35 mymk    
sq36 mymk    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-mymk No data available
PHENOTYPE
Phenotype resulting from CRISPR1-mymk
No data available

Phenotype of all Fish created by or utilizing CRISPR1-mymk
OTHER CRISPR1-mymk CRISPR PAGESNo links to external sites
CITATIONS (2)