CRISPR

CRISPR1-mymk

ID
ZDB-CRISPR-170504-1
Name
CRISPR1-mymk
Previous Names
  • CRISPR1-tmem8c
Target
Sequence
5' - GTTTGTGCCTGCAGCCAGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sq35 mymk
sq36 mymk
Expression
Gene expression in Wild Types + CRISPR1-mymk
No data available
Phenotype
Phenotype resulting from CRISPR1-mymk
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mymk
Phenotype Fish Conditions Figures
fast muscle cell mononucleate, abnormal mymksq35/sq35 standard conditions Fig. 1 with image from Zhang et al., 2017
myoblast fusion decreased occurrence, abnormal mymksq35/sq35 standard conditions Fig. 1 with image from Zhang et al., 2017
fast muscle cell nucleus decreased amount, abnormal mymksq35/sq35 standard conditions Fig. 1 with image from Zhang et al., 2017
myoblast fusion decreased occurrence, abnormal mymksq36/sq36 standard conditions Fig. 1 with image from Zhang et al., 2017
fast muscle cell mononucleate, abnormal mymksq36/sq36 standard conditions Fig. 1 with image from Zhang et al., 2017
supraneural amount, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
premaxilla decreased size, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
fast muscle cell nucleus decreased amount, abnormal mymksq36/sq36 standard conditions Fig. 1 with image from Zhang et al., 2017
ventral mandibular arch increased size, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
neural arch structure, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
precaudal vertebra neural arch increased ratio muscle, abnormal mymksq36/sq36 standard conditions Fig. 7. with image from Dhar et al., 2025
precaudal vertebra bone tissue mislocalised, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
cleithrum left-right axis asymmetrical, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
supraneural bone tissue mislocalised, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
cranium circular, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
head muscle decreased mass, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
coracoid decreased area, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
cranium morphology, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
cleithrum decreased area, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
supraneural size, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
coracoid left-right axis asymmetrical, abnormal mymksq36/sq36 standard conditions Fig. 6. with image from Dhar et al., 2025
Citations