header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170310-4
CRISPR Name: CRISPR1-ndrg4
Target: ndrg4 (1)
Source:
Target Sequence:
5' - GGTGATCCGTGGCGCTCCCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-ndrg4 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-ndrg4No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-ndrg4
Expressed Gene Anatomy Figures
mbpa Fig. 2 with image from Fontenas et al., 2016
ndrg4 Fig. 1 with image from Fontenas et al., 2016
sox10 Fig. 3 with image from Fontenas et al., 2016
PHENOTYPE
Phenotype resulting from CRISPR1-ndrg4
Phenotype of all Fish created by or utilizing CRISPR1-ndrg4
Phenotype Fish Conditions Figures
whole organism Ab3-snap25 labeling decreased amount, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
posterior lateral line nerve node of Ranvier decreased amount, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 2 with image from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle aggregated, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
myelination in peripheral nervous system disrupted, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 3 with image from Fontenas et al., 2016
eye decreased size, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
posterior lateral line nerve axon Ab3-snap25 labeling decreased distribution, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
pericardium edematous, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
thigmotaxis decreased process quality, abnormal WT + CRISPR1-ndrg4 standard conditions text only from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle ab-sv2 labeling spatial pattern, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
anatomical structure ndrg4 expression absent, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
posterior lateral line ganglion Ab3-snap25 labeling decreased distribution, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. S1 with image from Fontenas et al., 2016
myelination of posterior lateral line nerve axons decreased process quality, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 3 with image from Fontenas et al., 2016
whole organism decreased length, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
locomotion decreased process quality, abnormal WT + CRISPR1-ndrg4 standard conditions text only from Fontenas et al., 2016
whole organism decreased width, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
OTHER CRISPR1-ndrg4 CRISPR PAGESNo links to external sites
CITATIONS (1)