CRISPR

CRISPR1-ndrg4

ID
ZDB-CRISPR-170310-4
Name
CRISPR1-ndrg4
Previous Names
None
Target
Sequence
5' - GGTGATCCGTGGCGCTCCCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-ndrg4
Expressed Gene Anatomy Figures
mbpa Fig. 2 with image from Fontenas et al., 2016
ndrg4 Fig. 1 with image from Fontenas et al., 2016
sox10 Fig. 3 with image from Fontenas et al., 2016
Phenotype
Phenotype resulting from CRISPR1-ndrg4
Phenotype Fish Figures
anatomical structure ndrg4 expression absent, abnormal WT + CRISPR1-ndrg4 Fig. 1 with image from Fontenas et al., 2016
eye decreased size, abnormal WT + CRISPR1-ndrg4 Fig. 1 with image from Fontenas et al., 2016
locomotion decreased process quality, abnormal WT + CRISPR1-ndrg4 text only from Fontenas et al., 2016
myelination in peripheral nervous system disrupted, abnormal WT + CRISPR1-ndrg4 Fig. 3 with image from Fontenas et al., 2016
myelination of posterior lateral line nerve axons decreased process quality, abnormal WT + CRISPR1-ndrg4 Fig. 3 with image from Fontenas et al., 2016
pericardium edematous, abnormal WT + CRISPR1-ndrg4 Fig. 1 with image from Fontenas et al., 2016
posterior lateral line ganglion Ab3-snap25 labeling decreased distribution, abnormal WT + CRISPR1-ndrg4 Fig. S1 with image from Fontenas et al., 2016
posterior lateral line nerve axon Ab3-snap25 labeling decreased distribution, abnormal WT + CRISPR1-ndrg4 Fig. 5 with image from Fontenas et al., 2016
posterior lateral line nerve node of Ranvier decreased amount, abnormal WT + CRISPR1-ndrg4 Fig. 2 with image from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle aggregated, abnormal WT + CRISPR1-ndrg4 Fig. 5 with image from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle ab-sv2 labeling spatial pattern, abnormal WT + CRISPR1-ndrg4 Fig. 5 with image from Fontenas et al., 2016
thigmotaxis decreased process quality, abnormal WT + CRISPR1-ndrg4 text only from Fontenas et al., 2016
whole organism Ab3-snap25 labeling decreased amount, abnormal WT + CRISPR1-ndrg4 Fig. 5 with image from Fontenas et al., 2016
whole organism decreased length, abnormal WT + CRISPR1-ndrg4 Fig. 1 with image from Fontenas et al., 2016
whole organism decreased width, abnormal WT + CRISPR1-ndrg4 Fig. 1 with image from Fontenas et al., 2016
Phenotype of all Fish created by or utilizing CRISPR1-ndrg4
Phenotype Fish Conditions Figures
whole organism Ab3-snap25 labeling decreased amount, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
posterior lateral line nerve node of Ranvier decreased amount, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 2 with image from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle aggregated, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
myelination in peripheral nervous system disrupted, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 3 with image from Fontenas et al., 2016
eye decreased size, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
posterior lateral line nerve axon Ab3-snap25 labeling decreased distribution, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
pericardium edematous, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
thigmotaxis decreased process quality, abnormal WT + CRISPR1-ndrg4 standard conditions text only from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle ab-sv2 labeling spatial pattern, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
anatomical structure ndrg4 expression absent, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
posterior lateral line ganglion Ab3-snap25 labeling decreased distribution, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. S1 with image from Fontenas et al., 2016
myelination of posterior lateral line nerve axons decreased process quality, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 3 with image from Fontenas et al., 2016
whole organism decreased length, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
locomotion decreased process quality, abnormal WT + CRISPR1-ndrg4 standard conditions text only from Fontenas et al., 2016
whole organism decreased width, abnormal WT + CRISPR1-ndrg4 standard conditions Fig. 1 with image from Fontenas et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.