CRISPR

CRISPR2-flt1

ID
ZDB-CRISPR-170119-2
Name
CRISPR2-flt1
Previous Names
None
Target
Sequence
5' - GTATTGCAGCCGGCTGACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns29 flt1
Expression
Gene expression in Wild Types + CRISPR2-flt1
No data available
Phenotype
Phenotype resulting from CRISPR2-flt1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-flt1
Phenotype Fish Conditions Figures
retina pcna expression amount, ameliorated flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
retina dll4 expression increased amount, abnormal flt1bns29/bns29 (AB) standard conditions Fig. 3 from Mitra et al., 2022
retina hey1 expression increased amount, abnormal flt1bns29/bns29 (AB) standard conditions Fig. 3 from Mitra et al., 2022
retina hey1 expression increased amount, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
Muller cell cell population proliferation increased occurrence, ameliorated flt1bns29/bns29 (AB) physical alteration: retina Fig. 2 from Mitra et al., 2022
retina col15a1b expression increased amount, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
retina ascl1a expression increased amount, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
retina fgf8a expression increased amount, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
retina ab-4c4 labeling increased amount, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 4 from Mitra et al., 2022
retina mych expression increased amount, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
retina lin28ab expression increased amount, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
retina ccna2 expression amount, ameliorated flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
retina hbegfa expression amount, ameliorated flt1bns29/bns29 (AB) physical alteration: retina Fig. 3 from Mitra et al., 2022
Muller cell cell population proliferation increased occurrence, abnormal flt1bns29/bns29 (AB) physical alteration: retina Fig. 4 from Mitra et al., 2022
trunk vasculature dorsal region has extra parts of type vascular sprouts, abnormal flt1bns29/bns29; ci1Tg control Fig. 5 with image from Matsuoka et al., 2016
angiogenic sprout mislocalised, abnormal flt1bns29/bns29; ci1Tg control Fig. S6 with image from Matsuoka et al., 2017
trunk vasculature dorsal region has extra parts of type blood vessel, abnormal flt1bns29/bns29; ci1Tg control Fig. 5 with image from Matsuoka et al., 2016
regenerating tissue coronary artery increased length, abnormal flt1bns29/bns29; ci1Tg; hu5333Tg cryoablation: heart Fig. 4 with image from Marín-Juez et al., 2019
regenerating tissue coronary artery increased amount, abnormal flt1bns29/bns29; ci1Tg; hu5333Tg cryoablation: heart Fig. 4 with image from Marín-Juez et al., 2019
intersegmental vein vascular sprouts increased amount, abnormal flt1bns29/bns29; ci1Tg; hu5333Tg standard conditions Fig. 5 with image from Matsuoka et al., 2016
trunk vasculature dorsal region has extra parts of type vascular sprouts, abnormal flt1bns29/+; c264Tg; s995Tg chemical ablation: radial glial cell, chemical treatment by environment: metronidazole Fig. 7 with image from Matsuoka et al., 2016
vertebral artery absent, abnormal vegfabbns92/bns92; flt1bns29/bns29; ci1Tg control Fig. S6 with image from Matsuoka et al., 2017
angiogenic sprout mislocalised, abnormal vegfabbns92/bns92; flt1bns29/bns29; ci1Tg control Fig. S6 with image from Matsuoka et al., 2017
Citations