CRISPR

CRISPR1-flt1

ID

ZDB-CRISPR-170119-1

Name

CRISPR1-flt1

Previous Names

None

Target

flt1 (1)

Sequence

5' - GTGTCAGCCGGCTGCAATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
bns29	flt1

Expression

Gene expression in Wild Types + CRISPR1-flt1

No data available

Phenotype

Phenotype resulting from CRISPR1-flt1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-flt1

Phenotype	Fish	Conditions	Figures
retina pcna expression amount, ameliorated	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
retina dll4 expression increased amount, abnormal	flt1^bns29/bns29 (AB)	standard conditions	Fig. 3 from Mitra et al., 2022
retina hey1 expression increased amount, abnormal	flt1^bns29/bns29 (AB)	standard conditions	Fig. 3 from Mitra et al., 2022
retina hey1 expression increased amount, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
Muller cell cell population proliferation increased occurrence, ameliorated	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 2 from Mitra et al., 2022
retina col15a1b expression increased amount, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
retina ascl1a expression increased amount, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
retina fgf8a expression increased amount, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
retina ab-4c4 labeling increased amount, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 4 from Mitra et al., 2022
retina mych expression increased amount, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
retina lin28ab expression increased amount, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
retina ccna2 expression amount, ameliorated	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
retina hbegfa expression amount, ameliorated	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 3 from Mitra et al., 2022
Muller cell cell population proliferation increased occurrence, abnormal	flt1^bns29/bns29 (AB)	physical alteration: retina	Fig. 4 from Mitra et al., 2022
trunk vasculature dorsal region has extra parts of type vascular sprouts, abnormal	flt1^bns29/bns29; ci1Tg	control	Fig. 5 from Matsuoka et al., 2016
angiogenic sprout mislocalised, abnormal	flt1^bns29/bns29; ci1Tg	control	Fig. S6 from Matsuoka et al., 2017
trunk vasculature dorsal region has extra parts of type blood vessel, abnormal	flt1^bns29/bns29; ci1Tg	control	Fig. 5 from Matsuoka et al., 2016
regenerating tissue coronary artery increased length, abnormal	flt1^bns29/bns29; ci1Tg; hu5333Tg	cryoablation: heart	Fig. 4 from Marín-Juez et al., 2019
regenerating tissue coronary artery increased amount, abnormal	flt1^bns29/bns29; ci1Tg; hu5333Tg	cryoablation: heart	Fig. 4 from Marín-Juez et al., 2019
intersegmental vein vascular sprouts increased amount, abnormal	flt1^bns29/bns29; ci1Tg; hu5333Tg	standard conditions	Fig. 5 from Matsuoka et al., 2016
trunk vasculature dorsal region has extra parts of type vascular sprouts, abnormal	flt1^bns29/+; c264Tg; s995Tg	chemical ablation: radial glial cell, chemical treatment by environment: metronidazole	Fig. 7 from Matsuoka et al., 2016
vertebral artery absent, abnormal	vegfab^bns92/bns92; flt1^bns29/bns29; ci1Tg	control	Fig. S6 from Matsuoka et al., 2017
angiogenic sprout mislocalised, abnormal	vegfab^bns92/bns92; flt1^bns29/bns29; ci1Tg	control	Fig. S6 from Matsuoka et al., 2017

Citations