CRISPR

CRISPR5-th

ID
ZDB-CRISPR-170106-2
Name
CRISPR5-th
Previous Names
None
Target
Sequence
5' - GGGTTGTTACACTCATAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets within an intron of th.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ion27dTg th
ion32Tg th
m1512Tg th
m1513Tg th
m1514Tg th
Expression
Gene expression in Wild Types + CRISPR5-th
No data available
Phenotype
Phenotype resulting from CRISPR5-th
No data available
Phenotype of all Fish created by or utilizing CRISPR5-th
Phenotype Fish Conditions Figures
dopaminergic neuron mitochondrial mRNA surveillance decreased process quality, abnormal thion32Tg/ion32Tg; pt420Tg/pt420Tg chemical treatment by environment: metronidazole Figure 1 with image from Kim et al., 2021
dopaminergic neuron mitochondrion GFP expression spatial pattern, abnormal thion32Tg/ion32Tg; pt420Tg/pt420Tg chemical treatment by environment: metronidazole Figure 1 with image from Kim et al., 2021
dopaminergic neuron mitochondrion decreased amount, abnormal thion32Tg/ion32Tg; pt420Tg/pt420Tg chemical treatment by environment: metronidazole Figure 1 with image from Kim et al., 2021
dopaminergic neuron mitochondrion decreased speed, abnormal thion32Tg/ion32Tg; pt420Tg/pt420Tg chemical treatment by environment: metronidazole Figure 1 with image from Kim et al., 2021
dopaminergic neuron mitochondrion movement quality, abnormal thion32Tg/ion32Tg; pt420Tg/pt420Tg chemical treatment by environment: metronidazole Figure 1 with image from Kim et al., 2021
dopaminergic neuron mitochondrion increased length, abnormal thion32Tg/ion32Tg; pt420Tg/pt420Tg chemical treatment by environment: metronidazole Figure 1 with image from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
dopaminergic neuron ATP metabolic process normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
locomotion decreased process quality, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: L-dopa, chemical treatment by environment: metronidazole Figure 2 with image from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 5 with image from Kim et al., 2021
forebrain dopaminergic neuron atp6ap2 expression increased amount, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 5 with image from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: conduritol B epoxide Figure 5 with image from Kim et al., 2021
dopaminergic neuron monoatomic ion transmembrane transport increased frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
dopaminergic neuron ATP metabolic process normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
forebrain dopaminergic neuron semi-viable, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 3 with image from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 5 with image from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: conduritol B epoxide Figure 5 with image from Kim et al., 2021
forebrain dopaminergic neuron atp6ap2 expression increased amount, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: conduritol B epoxide Figure 5 with image from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 5 with image from Kim et al., 2021
dopaminergic neuron monoatomic ion transmembrane transport increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: conduritol B epoxide Figure 5 with image from Kim et al., 2021
dopaminergic neuron ATP metabolic process increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: conduritol B epoxide Figure 5 with image from Kim et al., 2021
dopaminergic neuron ribonucleotide biosynthetic process increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: conduritol B epoxide Figure 5 with image from Kim et al., 2021
dopaminergic neuron oxidative phosphorylation normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
dopaminergic neuron ATP metabolic process increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 5 with image from Kim et al., 2021
dopaminergic neuron respiratory electron transport chain normal frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
locomotion decreased process quality, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole, chemical treatment by environment: olmesartan Figure 2 with image from Kim et al., 2021
dopaminergic neuron monoatomic ion transmembrane transport increased frequency, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: L-dopa, chemical treatment by environment: olmesartan Figure 5 with image from Kim et al., 2021
dopaminergic neuron monoatomic ion transmembrane transport increased frequency, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 5 with image from Kim et al., 2021
locomotion decreased process quality, abnormal thion32Tg/ion32Tg; c264Tg/c264Tg chemical treatment by environment: metronidazole Figure 2 with image from Kim et al., 2021
forebrain dopaminergic neuron semi-viable, ameliorated thion32Tg/ion32Tg; c264Tg/c264Tg + CRISPR1-agtr1a + CRISPR2-agtr1b chemical treatment by environment: metronidazole Figure 3 with image from Kim et al., 2021
Citations