CRISPR
CRISPR1-irf8
- ID
- ZDB-CRISPR-161121-3
- Name
- CRISPR1-irf8
- Previous Names
- None
- Target
- Sequence
-
5' - GCGGTCGCAGACTGAAACAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "TGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR1-irf8
No data available
Phenotype
Phenotype resulting from CRISPR1-irf8
No data available
Phenotype of all Fish created by or utilizing CRISPR1-irf8
from 1 - 2 of 2
Citations
- Rutherford, H.A., Candeias, D., Duncan, C.J.A., Renshaw, S.A., Hamilton, N. (2024) Macrophage transplantation rescues RNASET2-deficient leukodystrophy by replacing deficient microglia in a zebrafish model. Proceedings of the National Academy of Sciences of the United States of America. 121:e2321496121e2321496121
- Weiss, A., D'Amata, C., Pearson, B.J., Hayes, M.N. (2024) A syngeneic spontaneous zebrafish model of tp53-deficient, EGFRvIII, and PI3KCAH1047R-driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapse in vivo. eLIFE. 13:
- Hamilton, N., Rutherford, H.A., Petts, J.J., Isles, H.M., Weber, T., Henneke, M., Gärtner, J., Dunning, M.J., Renshaw, S.A. (2020) The failure of microglia to digest developmental apoptotic cells contributes to the pathology of RNASET2-deficient leukoencephalopathy. Glia. 68(7):1531-1545
- Middel, V., Zhou, L., Takamiya, M., Beil, T., Shahid, M., Roostalu, U., Grabher, C., Rastegar, S., Reischl, M., Nienhaus, G.U., Strähle, U. (2016) Dysferlin-mediated phosphatidylserine sorting engages macrophages in sarcolemma repair. Nature communications. 7:12875
1 - 4 of 4
Show