CRISPR

CRISPR1-gal

ID
ZDB-CRISPR-160128-135
Name
CRISPR1-gal
Previous Names
  • CRISPR1-galn
  • Z000190 (1)
Target
Sequence
5' - GGATGGACCCTGAACAGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
o1 gal
Expression
Gene expression in Wild Types + CRISPR1-gal
No data available
Phenotype
Phenotype resulting from CRISPR1-gal
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gal
Phenotype Fish Conditions Figures
whole organism viability, exacerbated galo1/o1 bacterial treatment by injection: Mycobacterium marinum Figure 1 with image from Nowik et al., 2021
whole organism il1b expression decreased amount, abnormal galo1/o1 bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Nowik et al., 2021
whole organism il1b expression decreased amount, abnormal galo1/o1 bacterial treatment by injection: Staphylococcus aureus, chemical treatment by injection: Galanin-like peptide Figure 3 with image from Nowik et al., 2021
whole organism cxcl8a expression decreased amount, abnormal galo1/o1 bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Nowik et al., 2021
whole organism irg1l expression decreased amount, abnormal galo1/o1 bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Nowik et al., 2021
whole organism viability, ameliorated galo1/o1 bacterial treatment by injection: Staphylococcus aureus, chemical treatment by injection: Galanin-like peptide Figure 1 with image from Nowik et al., 2021
whole organism irg1l expression amount, ameliorated galo1/o1 chemical treatment by injection: Galanin-like peptide, bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Nowik et al., 2021
whole organism cxcl8a expression amount, ameliorated galo1/o1 chemical treatment by injection: Galanin-like peptide, bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Nowik et al., 2021
whole organism il1b expression decreased amount, abnormal galo1/o1 bacterial treatment by injection: Staphylococcus aureus Figure 3 with image from Nowik et al., 2021
whole organism viability, exacerbated galo1/o1 bacterial treatment by injection: Staphylococcus aureus Figure 1 with image from Nowik et al., 2021
whole organism tnfa expression decreased amount, abnormal galo1/o1 bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Nowik et al., 2021
whole organism il1b expression amount, ameliorated galo1/o1 chemical treatment by injection: Galanin-like peptide, bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Nowik et al., 2021
whole organism viability, ameliorated galo1/o1 chemical treatment by injection: Galanin-like peptide, bacterial treatment by injection: Mycobacterium marinum Figure 1 with image from Nowik et al., 2021
whole organism irg1l expression amount, ameliorated galo1/o1 bacterial treatment by injection: Staphylococcus aureus, chemical treatment by injection: Galanin-like peptide Figure 3 with image from Nowik et al., 2021
whole organism irg1l expression decreased amount, abnormal galo1/o1 bacterial treatment by injection: Staphylococcus aureus Figure 3 with image from Nowik et al., 2021
Citations