CRISPR

CRISPR1-junbb

ID
ZDB-CRISPR-160126-2
Name
CRISPR1-junbb
Previous Names
  • Z000057 (1)
Target
Sequence
5' - GGGTTACGGTCACAACGACG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
stl671 junbb
stl672 junbb
Expression
Gene expression in Wild Types + CRISPR1-junbb
No data available
Phenotype
Phenotype resulting from CRISPR1-junbb
Phenotype Fish Figures
lymph vessel development arrested, abnormal y1Tg + CRISPR1-junbb Fig. 6 with image from Kiesow et al., 2015
lymph vessel development delayed, abnormal y1Tg + CRISPR1-junbb Fig. 3 with image from Kiesow et al., 2015
thoracic duct absent, abnormal y1Tg + CRISPR1-junbb Fig. 6 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + CRISPR1-junbb Fig. 3 with image from Kiesow et al., 2015
Phenotype of all Fish created by or utilizing CRISPR1-junbb
Phenotype Fish Conditions Figures
swimming behavior decreased process quality, abnormal junbbstl671/stl671 (TU) transection: spinal cord, water flow Fig. 5 with image from Klatt Shaw et al., 2021
spinal cord regeneration decreased process quality, abnormal junbbstl671/stl671 (TU) transection: spinal cord Fig. 5 with image from Klatt Shaw et al., 2021
spinal cord axon regeneration decreased process quality, abnormal junbbstl671/stl671 (TU) transection: spinal cord Fig. 5 with image from Klatt Shaw et al., 2021
regenerating tissue glial cell gfap expression decreased amount, abnormal junbbstl671/stl671 (TU) transection: spinal cord Fig. 5 with image from Klatt Shaw et al., 2021
regenerating tissue glial cell proliferation decreased process quality, abnormal junbbstl671/stl671 (TU) transection: spinal cord Fig. 5 with image from Klatt Shaw et al., 2021
regenerating tissue glial cell decreased amount, abnormal junbbstl671/stl671 (TU) transection: spinal cord Fig. 5 with image from Klatt Shaw et al., 2021
swimming behavior decreased process quality, abnormal junbbstl672/stl672 (TU) transection: spinal cord, water flow Fig. 5 with image from Klatt Shaw et al., 2021
spinal cord axon regeneration decreased process quality, abnormal junbbstl672/stl672 (TU) transection: spinal cord Fig. 5 with image from Klatt Shaw et al., 2021
regenerating tissue glial cell gfap expression decreased amount, abnormal junbbstl672/stl672 (TU) transection: spinal cord Fig. 5 with image from Klatt Shaw et al., 2021
regenerating tissue glial cell gfap expression decreased amount, abnormal TU + CRISPR1-junbb + CRISPR5-junbb transection: spinal cord Fig. 4 with image from Klatt Shaw et al., 2021
regenerating tissue glial cell proliferation decreased process quality, abnormal TU + CRISPR1-junbb + CRISPR5-junbb transection: spinal cord Fig. 4 with image from Klatt Shaw et al., 2021
regenerating tissue glial cell decreased amount, abnormal TU + CRISPR1-junbb + CRISPR5-junbb transection: spinal cord Fig. 4 with image from Klatt Shaw et al., 2021
swimming behavior decreased process quality, abnormal TU + CRISPR1-junbb + CRISPR5-junbb transection: spinal cord, water flow Fig. 4 with image from Klatt Shaw et al., 2021
spinal cord regeneration decreased process quality, abnormal TU + CRISPR1-junbb + CRISPR5-junbb transection: spinal cord Fig. 4 with image from Klatt Shaw et al., 2021
thoracic duct absent, abnormal y1Tg + CRISPR1-junbb control Fig. 6 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + CRISPR1-junbb control Fig. 3 with image from Kiesow et al., 2015
lymph vessel development arrested, abnormal y1Tg + CRISPR1-junbb control Fig. 6 with image from Kiesow et al., 2015
lymph vessel development delayed, abnormal y1Tg + CRISPR1-junbb control Fig. 3 with image from Kiesow et al., 2015
swimming behavior decreased process quality, abnormal TU + CRISPR1-junbb + CRISPR5-junba + CRISPR5-junbb + CRISPR6-junba transection: spinal cord, water flow Fig. 4 with image from Klatt Shaw et al., 2021
thoracic duct absent, abnormal y1Tg + CRISPR1-junba + CRISPR1-junbb control Fig. 6 with image from Kiesow et al., 2015
vascular lymphangioblast absent, abnormal y1Tg + CRISPR1-junba + CRISPR1-junbb control Fig. 3 with image from Kiesow et al., 2015
lymph vessel development delayed, abnormal y1Tg + CRISPR1-junba + CRISPR1-junbb control Fig. 3 with image from Kiesow et al., 2015
lymph vessel development arrested, abnormal y1Tg + CRISPR1-junba + CRISPR1-junbb control Fig. 6 with image from Kiesow et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.