CRISPR

CRISPR1-junbb

ID
ZDB-CRISPR-160126-2
Name
CRISPR1-junbb
Previous Names
None
Target
Sequence
5' - GGGTTACGGTCACAACGACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-junbb
No data available
Phenotype
Phenotype resulting from CRISPR1-junbb
Phenotype of all Fish created by or utilizing CRISPR1-junbb
Citations