CRISPR

CRISPR1-kif5ba

ID

ZDB-CRISPR-151218-3

Name

CRISPR1-kif5ba

Previous Names

None

Target

kif5ba (1)

Sequence

5' - GGACAGGATAGCGTCGTGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 2

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ae11	kif5ba
ae12	kif5ba

Expression

Gene expression in Wild Types + CRISPR1-kif5ba

No data available

Phenotype

Phenotype resulting from CRISPR1-kif5ba

No data available

Phenotype of all Fish created by or utilizing CRISPR1-kif5ba

Phenotype	Fish	Conditions	Figures
whole organism lacks all parts of type notochord, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
whole organism wholly ventralized, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
somite cuboid, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
germ cell development decreased process quality, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
blastomere cleavage furrow nanos3 expression absent, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
head decreased size, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
chondrocyte endoplasmic reticulum position, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte mitochondrion position, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
head flattened, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
testis lacks all parts of type germ line cell, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased distribution, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
whole organism lacks all parts of type primordial germ cell, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region has extra parts of type unfertilized egg cortical granule, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 7 from Campbell et al., 2015
germ cell development decreased process quality, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
whole organism wholly ventralized, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
egg activation decreased process quality, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
somite cuboid, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
unfertilized egg sybu expression increased amount, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg microtubule disorganized, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 7 from Campbell et al., 2015
head decreased size, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
whole organism lacks all parts of type notochord, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased amount, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
testis lacks all parts of type germ line cell, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased distribution, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
germ cell development decreased process quality, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region wnt8a expression mislocalised, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
whole organism wholly ventralized, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
egg activation decreased process quality, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
somite cuboid, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
blastomere cleavage furrow nanos3 expression absent, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
head decreased size, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
whole organism lacks all parts of type notochord, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased amount, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12; ba2Tg	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
Meckel's cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
Meckel's cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
trunk skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
caudal fin skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
palatoquadrate cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
ceratohyal cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, exacerbated	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
head flattened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
extraocular musculature M band morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
ceratohyal cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
chondrocyte endoplasmic reticulum position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
whole organism Ab3-mtor labeling decreased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
whole organism ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	control	Fig. 5 from Santos-Ledo et al., 2017
TOR signaling decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte degenerate, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte vacuole increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	chemical treatment by environment: ammonium chloride	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
palatoquadrate cartilage chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
Meckel's cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
Meckel's cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
perichondral bone autophagy occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 , Fig. 2 from Santos-Ledo et al., 2017
chondrocyte rough endoplasmic reticulum distended, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
trunk skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte mitochondrion position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
caudal fin skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
palatoquadrate cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
perichondrium disorganized, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
whole organism ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	chemical treatment by environment: ammonium chloride	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, exacerbated	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
palatoquadrate cartilage chondrocyte circular, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
head flattened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
extraocular musculature M band morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
chondrocyte ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	control	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
perichondral bone bone mineralization decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
entopterygoid decreased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
chondrocyte centrosome polarity, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
perichondral bone autophagy occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
dentary decreased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
branchiostegal ray decreased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
chondrocyte lysosome increased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
endochondral bone bone mineralization decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte centrosome position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte ab8-rps6 labeling decreased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage apoptotic process increased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte apoptotic process increased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton decreased size, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton decreased size, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017

Citations

Include unpublished citations

Campbell, P.D., Heim, A.E., Smith, M.Z., Marlow, F.L. (2015) Kinesin-1 interacts with Bucky ball to form germ cells and is required to pattern the zebrafish body axis. Development (Cambridge, England). 142(17):2996-3008

1 - 1 of 1

Show