CRISPR

CRISPR1-tjp1b

ID

ZDB-CRISPR-150731-12

Name

CRISPR1-tjp1b

Previous Names

Z000460 (1)

Target

tjp1b (2)

Sequence

5' - GAGTGCAGCAATGGATGAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

CRISPRz:Z000460 (1)

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
b1370	tjp1b
fh448	tjp1b
fh449	tjp1b
fh451	tjp1b

Expression

Gene expression in Wild Types + CRISPR1-tjp1b

No data available

Phenotype

Phenotype resulting from CRISPR1-tjp1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-tjp1b

Phenotype	Fish	Conditions	Figures
Mauthner neuron chemical synaptic transmission absent process, abnormal	tjp1b^b1370/b1370	mechanical stress, chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid	Figure 3 from Lasseigne et al., 2021
Mauthner neuron chemical synaptic transmission normal occurrence, ameliorated	tjp1b^b1370/b1370	chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid	Figure 4 from Lasseigne et al., 2021
startle response increased sensitivity of a process detection of mechanical stimulus, abnormal	tjp1b^b1370/b1370	mechanical stress	Figure 5-source data 1. from Lasseigne et al., 2021
Mauthner neuron chemical synaptic transmission increased magnitude, abnormal	tjp1b^b1370/b1370	standard conditions	Figure 4 from Lasseigne et al., 2021
Mauthner neuron cell communication by electrical coupling decreased occurrence, abnormal	tjp1b^b1370/b1370	mechanical stress	Figure 3 from Lasseigne et al., 2021
Mauthner neuron cell communication by electrical coupling decreased magnitude, abnormal	tjp1b^b1370/b1370	mechanical stress, chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid	Figure 3 from Lasseigne et al., 2021
startle response delayed, abnormal	tjp1b^b1370/b1370	mechanical stress	Figure 5-source data 1. from Lasseigne et al., 2021
Mauthner neuron cell communication by electrical coupling decreased frequency, abnormal	tjp1b^b1370/b1370	standard conditions	Figure 4 from Lasseigne et al., 2021
startle response decreased magnitude, abnormal	tjp1b^b1370/b1370	mechanical stress	Figure 5-source data 1. from Lasseigne et al., 2021
Mauthner neuron protein localization to synapse disrupted, abnormal	tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1 from Lasseigne et al., 2021
Mauthner neuron dendrite gjd2a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1 from Lasseigne et al., 2021
Mauthner neuron dendrite gjd1a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1 from Lasseigne et al., 2021
Mauthner neuron synapse ab1-tjp1 labeling absent, abnormal	tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1 from Lasseigne et al., 2021
Mauthner neuron synapse gjd1a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1 from Lasseigne et al., 2021
Mauthner neuron synapse gjd2a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1 from Lasseigne et al., 2021
Mauthner neuron dendrite ab1-tjp1 labeling absent, abnormal	tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1 from Lasseigne et al., 2021
Mauthner neuron gap junction ab3-gjd2 labeling absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 1 from Marsh et al., 2017
Mauthner neuron gap junction gjd2a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
spinal cord interneuron gap junction gjd2a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
Mauthner neuron gap junction assembly decreased occurrence, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 1 from Marsh et al., 2017
spinal cord interneuron gap junction ab1-tjp1 labeling absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
spinal cord interneuron gap junction ab3-gjd2 labeling absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 1 from Marsh et al., 2017
Mauthner neuron gap junction gjd1a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
Mauthner neuron gap junction-mediated intercellular transport arrested, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 1 from Marsh et al., 2017
spinal cord interneuron gap junction gjd1a expression absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
spinal cord interneuron gap junction-mediated intercellular transport arrested, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 1 from Marsh et al., 2017
Mauthner neuron gap junction ab1-tjp1 labeling absent, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
spinal cord interneuron gap junction assembly decreased occurrence, abnormal	tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 1 from Marsh et al., 2017
Mauthner neuron synapse assembly decreased process quality, abnormal	tjp1b^b1435/+; tjp1b^b1370/+; zf206Et (AB/TU)	standard conditions	Fig. 1 from Michel et al., 2022
spinal cord interneuron synapse assembly decreased process quality, abnormal	tjp1b^b1435/+; tjp1b^b1370/+; zf206Et (AB/TU)	standard conditions	Fig. 1 from Michel et al., 2022
Mauthner neuron synapse absent, abnormal	tjp1b^fh448/+; tjp1b^fh449/+	standard conditions	Fig. 2 from Shah et al., 2015
Mauthner neuron dendrite gjd2a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron synapse tjp1a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron dendrite gjd1a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron synapse gjd1a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron synapse gjd2a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron dendrite tjp1a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et	standard conditions	Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
spinal cord interneuron gap junction gjd2a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
spinal cord interneuron gap junction ab1-tjp1 labeling absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
Mauthner neuron gap junction gjd1a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
Mauthner neuron gap junction ab1-tjp1 labeling absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
spinal cord interneuron gap junction gjd1a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
Mauthner neuron gap junction gjd2a expression absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017
spinal cord neuroepithelial cell ab1-tjp1 labeling absent, abnormal	tjp1a^fh463/fh463; tjp1b^b1370/b1370; zf206Et (AB/TU)	standard conditions	Fig. 2 from Marsh et al., 2017

Citations