header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-150311-8
CRISPR Name: CRISPR8-aldh1a2
Target: aldh1a2 (1)
Previous Name: intron 4 ali4gR10 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGCCTGCAGGAGATGTTGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR8-aldh1a2 No data available
GENOMIC FEATURES CREATED WITH CRISPR8-aldh1a2 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR8-aldh1a2 No data available
PHENOTYPE
Phenotype resulting from CRISPR8-aldh1a2
No data available

Phenotype of all Fish created by or utilizing CRISPR8-aldh1a2
No data available
Genome Resources:
CITATIONS (1)