ZFIN ID: ZDB-CRISPR-150311-1
CRISPR Name: CRISPR1-aldh1a2
Target: aldh1a2 (1)
Previous Name: intron 3, ali3gR11 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GACCCAAGATTCTCTAAGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-aldh1a2 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-aldh1a2
Genomic Feature Affected Genomic Regions    
nju26Tg aldh1a2    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-aldh1a2 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-aldh1a2
No data available

Phenotype of all Fish created by or utilizing CRISPR1-aldh1a2
No data available
Genome Resources:
CITATIONS (2)