CRISPR

CRISPR1-gja4

ID
ZDB-CRISPR-150303-1
Name
CRISPR1-gja4
Previous Names
  • CRISPR1-cx39.4
Target
Sequence
5' - GGAAGGCCAGGAGTACTCGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
t32241 gja4
Expression
Gene expression in Wild Types + CRISPR1-gja4
No data available
Phenotype
Phenotype resulting from CRISPR1-gja4
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gja4
Phenotype Fish Conditions Figures
melanophore stripe broken, abnormal gja4t32241/t32241 standard conditions Fig. 8 with image from Fadeev et al., 2015
iridophore pigmentation process quality, abnormal gja4t32241/t32241 standard conditions Fig. 8 with image from Fadeev et al., 2015
pigmentation disrupted, abnormal gja4t32241/t32241 standard conditions Fig. 3 with image from Irion et al., 2014
melanophore stripe patchy, abnormal gja4t32241/t32241 standard conditions Fig. 3 with image from Irion et al., 2014
pigmentation process quality, abnormal gja4t32241/t32241 standard conditions Fig. 8 with image from Fadeev et al., 2015
melanophore stripe spotted, abnormal gja4t32241/t32241 standard conditions Fig. 3 with image from Irion et al., 2014
melanophore stripe patchy, abnormal gja4t32241/t32241(TU) standard conditions Fig. 1 with image from Frohnhöfer et al., 2016
integument pigmentation disrupted, abnormal gja4t32241/t32241(TU) standard conditions Fig. 1 with image from Frohnhöfer et al., 2016
melanophore stripe absent, abnormal gja5bt1/t1; gja4t32241/t32241 standard conditions Fig. 3 with image from Irion et al., 2014
melanocyte dispersed, abnormal gja5bt1/t1; gja4t32241/t32241 standard conditions Fig. 3 with image from Irion et al., 2014
melanophore stripe patchy, abnormal srmt26743/t26743; gja4t32241/t32241(TU) standard conditions Fig. 1 with image from Frohnhöfer et al., 2016
integument pigmentation disrupted, abnormal srmt26743/t26743; gja4t32241/t32241(TU) standard conditions Fig. 1 with image from Frohnhöfer et al., 2016
melanophore stripe absent, abnormal tjp1atnh009b/tnh009b; gja4t32241/t32241 standard conditions Fig. 8 with image from Fadeev et al., 2015
pigmentation process quality, abnormal tjp1atnh009b/tnh009b; gja4t32241/t32241 standard conditions Fig. 8 with image from Fadeev et al., 2015
iridophore pigmentation process quality, abnormal tjp1atnh009b/tnh009b; gja4t32241/t32241 standard conditions Fig. 8 with image from Fadeev et al., 2015
Citations