header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181010-9
Genomic Feature: az9
Synonyms:
Affected Genomic Regions: otpb (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-otpb
Lab Of Origin: Sato Lab
Location: Chr 5: 51619141 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CATTCCATTAGGATTGGATCCACCATTACTTATTTCTTCTCCGGGGAGCAGAGTGGTCCCCTCCACAGTCTCTGTGGCAGAAGTAAGGTCGCCGGGGTGTCCAGAGTCAGTCCCCCCTAGTCTGCATTTTAAAGCTTCTCGGTGTACGAGAAGCTCGGCTGCAGCATCCTTCATCCCTGTGGACGCAGGTGTCAACAATTTAGCATTCTATCCAAATGGCTGTTTCATATTAATATCAATAATCAACGCATATTTAAAACACGCTACTTATTGATACATTTGTCGCACAAATAATCATAAACATATAGCAAATAATACCAAACATAAACACCACAAACATTAAAATTATTTTAGCAAGGGAAAAAAACAATACTTTTAGTAATTATCACGTAACATTGCATGTATAATGCACATATTAAAATATAATATAAACATAAAATTGGTTCACCAGACTGAAGACTGAATAATACTCTAGCTTACAGTGGAGTTGAAGACCGGAG
T/-
TTGGTGGCGATAACTCACCGAGGCGAGTATCCAAGAGGTCGGCATGAGAGAGCATTGCGCACTGCTGGAGTCACAACTGCTTCCCAAACTACTCTACAACTTTAACCCTTTTAAAAAGCGCATAGGGCTCAATTGAAGCAAAGTCGTCAGTGCGTTTAAAAAGGCGGTTCCACGTATTATACTGTTCTTTAGAGAGATTGGGAGGCGCTTAATAGTTGTATGAGCCCGTGAGCTTCCACAAATGGGAACCAATCAGAATTAAGGGCTGAAAATGTCAGACAACCAACCACTAAAATCCACAAACCGGTTTCATCTGCGGTTGCTCTCGTTCATTTCAAATCTGATTTATTGCATTGCCCCCTTATTAGCTATACATTTTAAATGACTTCATAATCATGGCAAATAACCAGCGAATAATAAATCTTTCTGTAGAGGCTTCACAAAAGGTGCAAAAGTCGAATTTATACGACTTGGCCGACTAGGGATGTAATCTCTAAATA
OTHER az9 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)