header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180724-11
CRISPR Name: CRISPR1-otpb
Target: otpb (1)
Source:
Target Sequence:
5' - GGGTTATCGCCACCAAACTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The second "G" does not match the target sequence but was added to increase efficiency.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-otpb No data available
GENOMIC FEATURES CREATED WITH CRISPR1-otpb
Genomic Feature Affected Genomic Regions    
az10 otpb    
az9 otpb    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-otpb No data available
PHENOTYPE
Phenotype resulting from CRISPR1-otpb
No data available

Phenotype of all Fish created by or utilizing CRISPR1-otpb
No data available
Genome Resources:
CITATIONS (1)