Genomic Feature

fb101

ID
ZDB-ALT-140623-1
Name
fb101
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Langenau Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 25: 9011592 - 9011594 (GRCz11) (1) Details
Nucleotide change
TCA/GC
Variant Notes
The indel mutation comprises a three nucleotide deletion and two nucleotide  ...
The mutation is: E450fs
The mutation is: E450fs
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp inserted / 3 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
None
Sequences
Flanking Sequence
CAGCCGTAAGTGATCTATAGCTGATTAACCATGTGGATGCATGATAACAGCCTTCTGAACCTACAAGTAGGCCCAGAAGGCCCCTACTGGCCCACATCTATAGGCTGATAACCACTCATAATGCCCATTCAATACAGTGATAACATTTGAAACGGCTGTTTTAAAGTACTTTCCAGGCCTTGAATCCATAAGTCTGAAATTCAAATACTTTCAAGTATTTTCAACAAGAACCATGTGAAGAGAAAAGAAGAACAAATCAGTCAAAAAGTCTTCGCAGAAAGGTCTTCTTAGCTGGGGTCATCTTCAGTGAGACAGGAGCCTTGCGGTGGGTCATCTTCATTGGGACTCTCTTCACTGGTAACATCTGCTTCGGAGGAGTCATCTCCTGTTTGGGCAGGCCACCATGATCCAAGCAGAAGTACTTGCTGTTATCTTGGGAGAGTTGGAGCAGAAGGCTTTCAGGGAGCTCCATGCATTGGGCATGGACCCAGTGTCCACCT
TCA/GC CCCCTGGAGCAGAAGATCATGGCAGGTCGGGTGAGCTCAGTAGAATAGTAGGGCTCCCAGATATTGGGGTCCACCTGGCAGGACAGGCAGCACTTGATCCAGTAGCCTGTCTGAGATTCATCCTCCTCATCTTCCTCGTTATAGGTGTCGCCCTCTACATCGCTGCTATACTCCAGCTCGTGAGGCTCTCGGCCAAAGTACAGCTCCTCAGAGTCTTCCAAAGGTGCAGAGTCCTCGAAATCAGTGGACTCCTGGCTGCCTCCCTGTGCCGTAGCTTCTCCATCTTGTTCCTTCTGGAAGCTCACTTGGTAGAAATGGTAGGCTTCTGGCGGGGTCGGGTTTCCTTCTGAAGGAATTGCAACTAGAGCAGTTCCTTTGCCCAAGCTGCCACCAAACCAAGTACGACTGTGGCTGATCTCGCTGGTCCACTGTGGAGGTTCGCGAGACTCCATATGGACTCCCACATCATCCAGGCCAACGTAGGTGCACTCCATGCGCTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations