header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-100506-16
Genomic Feature: hu3237
Synonyms:
Affected Genomic Regions: otx2b (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Cuppen Lab
Location: Chr 17: 44246355 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TCCGTTTTGTTGTTGTTGCTGCTGTTGGCGACACTTTGCCCTTCGGTTTT
T/A
GAACCAAACCTGATGTGTTGAAAAAAAGGGGTTTTTATTATTTACGACGT
(1)
OTHER hu3237 PAGES
ZMP:hu3237 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous otx2bhu3237/hu3237 (TL) otx2b ♀+/- ♂+/-
Unknown otx2bhu3237 otx2b Unknown

CITATIONS  (5)