Genomic Feature
w59
- ID
- ZDB-ALT-080206-1
- Name
- w59
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one point mutation (1)
- Protocol
- ENU
- Lab of Origin
- Brockerhoff Lab
- Current Source
- Zebrafish International Resource Center (ZIRC) ( order this )
- Other Pages
Notes
No data available
Variants
- Variant Type
- Point Mutation
- Variant Location
- Chr 12: 5144668 (GRCz11) (1) Details
- Nucleotide change
- A/G
- Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- A>G (1)
- Transcript Consequence
- Frameshift (1)
- Protein Consequence
- Polypeptide Truncation (1)
- Flanking Sequence
-
CGGCAAGCCATTCGAAGAGCAGGATGAACAGATTACTGAAGTGAGTGGCCACACGCTCACAACAGCTTTGACTCTTAGTATCATGTGCTGCGACTTTACTTTCTGTTTCATTGAACTTTATTTCAGGCTCTAACACAGTTCCTGGGATGGTCCGTACTGAACTGCGACACATATGACAAACTGAACCGGATGGAGTGGAGGAAAGAAATTGCAGAAGAAATGGTCATGTATCAGACCAAAGCCACTCCGGCTGAAGTCCAGCAGATTCTGGTTAGATGATGAGCTTTTTCCTGTCAGAAAAAAAGTCCAGTCTTGTTTTATAACATTGACTAAACATTTTATGTGTCTCATTAGAACACAAAGGAGAAGTTTGACCAGAACCCGGAAGACTGCGATCAGAAAGAAATGTACAAACTCTTGGTACGACCAGATTTCAGAGTGAACACGAGACTGATTATTAAAAAGGATGATTTACTAAATCCACTTTTATTTTAACACAC
A/G GAGAGCCAACATTCCAGAGGCCAAAGATGTCGATCTGCTAGAATTTAGTTTCAGTGACTTCCCTCTGACTGAAACCGATCTCATCAAGTGCGGCATTCGCTGCTTCTTTGAACTGGGAGTGGTGGAGAAGTTCAAGGTGCCAGCAGAGGTGAGACGTCCGCATCAACACACTAGACTTTGAGCAAGCAAGCTTTTCATTCGATGTTACATCACTTATTTGAAAACAAGTGTGCCCCCTCATGGGTTTAGATCCCAGAGAAGATATTTGCCATTTTAAGATTCTTAATATATCGTTGAGTGTGTGAAAGGCTAAATACACACAGTTTTATGACTCAAACGTAACTTTAAAGATGATTTACCACAAAAGACTTATGATACCTGAAGCTGCTCCATATCTAGGCCTATCAATTTTGTTGATAAACCTGAAGATGTACACTTAGATTAACTTTTAGAGCATAAAAGTGATCAGTGTTTTATTCTAAGTCAAATAAATTTACTTT - Additional Sequence
- None
Fish
| Fish | Genomic Feature Zygosity | Parental Zygosity | Affected Genomic Regions | Phenotype | Gene Expression |
|---|---|---|---|---|---|
| pde6cw59/w59 | Homozygous | ♀+/- ♂+/- | 13 figures  from 6 publications | 3 figures from 2 publications | |
| pde6cw59/+ (AB) | Heterozygous | Unknown | |||
| pde6cw59/+ (WIK/AB) | Heterozygous | Unknown | |||
| pde6cw59/w59; q13Tg | Complex | Fig. 7 from Saade et al., 2013 | |||
| pde6cw59/w59; q16aTg; q16bTg | Complex | 4 figures from Saade et al., 2013 | 3 figures from Saade et al., 2013 | ||
| pde6cw59/w59; ucd1Tg | Complex | 3 figures from Viringipurampeer et al., 2014 | 4 figures from Viringipurampeer et al., 2014 | ||
| pde6cw59/w59; w62Tg | Complex | 2 figures from Lewis et al., 2010 | |||
| pde6cw59/w59; mpv17a9/a9; w126Tg | Complex | ||||
| pde6cw59/w59; mpv17a9/a9; w127Tg | Complex | ||||
| pde6cw59/w59 + MO2-ripk3 | Complex | Fig. 7 from Viringipurampeer et al., 2014 |
1 - 10 of 12
Show
Supplemental Information
- Genotyping protocol
- None
- Saddala, M.S., Lennikov, A., Bouras, A., Huang, H. (2020) RNA-Seq reveals differential expression profiles and functional annotation of genes involved in retinal degeneration in Pde6c mutant Danio rerio. BMC Genomics. 21:132
- Hutto, R.A., Bisbach, C.M., Abbas, F., Brock, D.C., Cleghorn, W.M., Parker, E.D., Bauer, B.H., Ge, W., Vinberg, F., Hurley, J.B., Brockerhoff, S.E. (2019) Increasing Ca2+ in photoreceptor mitochondria alters metabolites, accelerates photoresponse recovery, and reveals adaptations to mitochondrial stress. Cell death and differentiation. 27(3):1067-1085
- Iribarne, M., Nishiwaki, Y., Nakamura, S., Araragi, M., Oguri, E., Masai, I. (2017) Aipl1 is required for cone photoreceptor function and survival through the stability of Pde6c and Gc3 in zebrafish. Scientific Reports. 7:45962
- Zhang, L., Zhang, X., Zhang, G., Pang, C.P., Leung, Y.F., Zhang, M., Zhong, W. (2017) Expression profiling of the retina of pde6c, a zebrafish model of retinal degeneration. Scientific data. 4:170182
- George, A.A., Hayden, S., Stanton, G.R., Brockerhoff, S.E. (2016) Arf6 and the 5'phosphatase of synaptojanin 1 regulate autophagy in cone photoreceptors. BioEssays : news and reviews in molecular, cellular and developmental biology. 38 Suppl 1:S119-35
- Glaviano, A., Smith, A.J., Blanco, A., McLoughlin, S., Cederlund, M.L., Heffernan, T., Sapetto-Rebow, B., Alvarez, Y., Yin, J., Kennedy, B.N. (2016) A method for isolation of cone photoreceptors from adult zebrafish retinae. BMC Neuroscience. 17:71
- Zhang, L., Xiang, L., Liu, Y., Venkatraman, P., Chong, L., Cho, J., Bonilla, S., Jin, Z.B., Pang, C.P., Ko, K.M., Ma, P., Zhang, M., Leung, Y.F. (2016) A Naturally-Derived Compound Schisandrin B Enhanced Light Sensation in the pde6c Zebrafish Model of Retinal Degeneration. PLoS One. 11:e0149663
- Gao, Y., Chan, R.H., Chow, T.W., Zhang, L., Bonilla, S., Pang, C.P., Zhang, M., Leung, Y.F. (2014) A High-Throughput Zebrafish Screening Method for Visual Mutants by Light-Induced Locomotor Response. IEEE/ACM transactions on computational biology and bioinformatics. 11(4):693-701
- Jia, S., Muto, A., Orisme, W., Henson, H.E., Parupalli, C., Ju, B., Baier, H., and Taylor, M.R. (2014) Zebrafish Cacna1fa is required for cone photoreceptor function and synaptic ribbon formation. Human molecular genetics. 23(11):2981-94
- Swartz, M.E., Wells, M.B., Griffin, M., McCarthy, N., Lovely, C.B., McGurk, P., Rozacky, J., and Eberhart, J.K. (2014) A Screen of Zebrafish Mutants Identifies Ethanol-Sensitive Genetic Loci. Alcoholism, clinical and experimental research. 38(3):694-703
1 - 10 of 16
Show