Genomic Feature

zf3144

ID
ZDB-ALT-201201-8
Name
zf3144
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Vascular Signaling Group
Current Source
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Delins
Variant Location
Chr 7: 21899567 - 21899578 (GRCz11) (1) Details
Nucleotide change
CACAGATGGGG/ATTAAA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
6 bp inserted / 11 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TGAACAATGCCACATTACACATGAATAAACGATTGAATCTTGAATTGAACAATTGAATGCCCATTTGTTGTCTACAACTCCCCATGATACCTTACGTTAAGGAAATTGTGCCGAAATCATGACAAAATTGTGTGATCTGACCAGGGCTTTACTTACCAAGCCTCTTTCTTTTTTGTTATACATGATTAAATCATTATGCTGTGTTTTAGAATTTGTCTGAAATCTGTTTTATAAGGTGCCTTTGTGCAGTAACACTTCATCCAGAGTCACTGCCTGATTGGCAAGTCACAGTCTAGCTATCTAGCTTTCAGACATAGCTAATGTTTTTGCAAAGATGCTTGGTTGATGCACGTATGAGATTAAAACTGTAGATGAAAAGCAAGAAAGTAGGGATTCCTGTCAAATGTGTTTATGAACTTTATCCATCATGTGCATGTCTCTCACCATAGCAGCCTCTGCATCCCATGCCTCCTTAATGAAATGGTCGAGGACGCGCAGGT
CACAGATGGGG/ATTAAA GTAATGGGGAGGACAGGCCTGGACGGGTCCACTCCAGCACCATCAGCAGTAAGGCAAAGAGTCCTGATGCACAAACAACAAATTTGGATGAAACTGAAGAAAATTAAAGATCTGGCAAGCCTGCACTCATAACAGGACATCCAGAAGAGTTGTTCTGTGAGATTAAACATTTCCTACTCTCCAAACCTGCTTCCTGGCATAGCAATTGTATACAGATGCCAGCAGTGGCTTCAAAACTTTAATAATAATAATATGAAAGGAAAAATATGTAAAAGTTTACACTGACAATTTAATAGAACAAAACATGAACATATTGTACAAAACTATAGGCAGGCTGTGAAGTTGAATAAAATGGTTTGATTTAAACCGCATTATTAAAGATTGTTAAATGAAAACTTTAAATTGTAACAACTGAACATACAGTAAGTGCATATTATTTCAAATGAATGCTTAATTAAGGGTCATCTGTACATGCTAAAAAAATAAACCAGTAAAACAAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations