Genomic Feature

bns3

ID
ZDB-ALT-180824-2
Name
bns3
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 21: 7240257 - 7240265 (GRCz11) (1) Details
Nucleotide change
TACTCACGG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
9 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TCATTCAAATACTAGCTCTAACATGACGTTGGTGAAGTAGCAATGGTTCTGCTGTTCTGACCATCAGCTGCAGATTTGTATGAAAGGTGGAAGAAAGTTGTTCCTCTAGTGTCTAGAAAGTAGTATACTGTAATACTGATTATATATGTAAATATATTTCTTTTGAGTATTTTAGTTTTTTATTATGTGTGTATTTATACATATATAGATAAATATACACATATGTAAATTTATTTTTACATATTTATTTTACTCAAATATATTCAATGAAAATATTCACAGTTAATTAAATTAAATATTAAGACATTGTAAAATATGCAAACAAACATACAACAAACAAATTAAAGACAACACATCTGCCAAGTAATATGAATTGATAACATGTTAAGTCATAGATGAGCAGCTGGTTTTTCGGTGGGTCTGTTTCTAGTGTTTTTTTATGCAGTCGGACGTGCTCAGTCTGTAGGTTATAGTTGTGTTCACCAGTCACAGTGCACTAT
TACTCACGG/- TACGAGTTGAGAGTGGCATAGCGCGTACCAAAAGTAATAATGAACCGTGAGGCCGGTAAGACTCAAATCTCCACCTGCAGCAGTGCTAGAGGACACACACACTTAAACACAGCAGTATAACACACCCACAATCAATTCGATTGCGCTTATACAATGCAGATTCTGTAAAAGCAGACAATAACCATTCACACATTCTCATACACCGCCATCATATTACCACAACATAAACATTGTAAAAGTGTTTAACACTCCTGAATAGCCTGAGTAAGTGCGTCTCTGTTGAAATGAGTGTGTGAAAGTGCTGGATTTGCAGTGGGTTGGTGAAGTATGTGTCTGTACATGCGTTTTCAGTTATTGTTGCCCACAAGCCCTTGTGCAATGGAAACAGGGAAAACTGAGACGGTTTTCTCCCACATTTTCAGAAAGTGGTCAGGAATGTGAGACCAGAACTGTCATGATAGCTTATGAAGGTATGAAGAGAGGATAATGAGTTATAAAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations