ZFIN ID: ZDB-ALT-180628-7
Genomic Feature: el506
Synonyms:
Affected Genomic Regions: nr2f2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN2-nr2f2
Lab Of Origin: Crump Lab
Location: Chr 18: 23874654 - 23874661 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted from position 725 to 732 in RefSeq:NM_131183.1 in Exon 1 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: at position 128 (1)
FLANKING SEQUENCE (GENOMIC)
TTGTGGTCGATCTGGAGTCCCTAGCTTAGTGTGTGTGTATGTGAGCGCGCGTGTGTGTATATGTGATTTTGACGCTGCTTCTCCATACTCCCTCGCCATAACCGCACGGCATATCTGCAGTGATTATAAAAATAAAGACAAATACCCATGTTTTCGTCGCCTAATAAAAGCAATGGTTAGTTTAAAGCTGCGAACATGTGCAATGCGAAATAGTCGCTAAGGAGAGGGTGTTCTTTATTCGAGCATTAAGGGCGCCGTGATAACGCTCAGTCTCGAGCGCTATAGGCGGTTCCTTCGCATGCTGTGGACGGGCAGATTGAGAGAGAGGAGTCGGGGATAAAATACAGGAAGAAGCATGCGCGATTAAGTCAGGCTAAATACAGAAGACAAAGACAAAGACAGCAGTAAAACAACAAAAATCCGAATACCTTCCCGTCTCATGCCAACTTTGAGGCATTTTTTGAGGCGGCAGTACTGACACTGATTGCGATGGTGCTGGT
CAATGGGA/-
CAATTCCTGTTGGCACGGCATGTGTAAGTGAGGTTCCTTCGTACGCTCCGTTTGAAAAAGCTTTTGCACCCCTCGCAAGTGAACTGGCCATAGTGTTTACCGCTGGATTTGTCCCCGCAAACCACGCACTCTATATGCTGTGGCTGCTGCTTTTCCGACTGGCTCTGCGTCGTCTGGTTCGTCGGGGTTGACTGTGTGTTGTTATTGTTGTTCGGGGGTCCTTGAACGGGTGTCTGAGGGGTCGGAGGGGCAACCTGAGAGGCCGTCAGACCCAGCTGGCCTGGTTGAGGGGTCGGAAGGGATAGTCCTCCTTGGGTTTGCGATGAGAGGGTGCCATGGGTCTCGGCCACATCGTCCTGGGAGCCTCTCCACACTACCATTGCCATATCTATCAGTCAACGTTAAAAAAACTTTTTGTTCCCCGTTTTTGGTTTCGGAATGCTTTGTTTAAAAAAATAATATCGCAGCACGGTGCCTCTATCACTTAGGAGGGTAAAATA
OTHER el506 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous nr2f2el506/el506 nr2f2 ♀+/- ♂+/-
Heterozygous nr2f2el506/+ nr2f2 ♀+/- ♂+/-
Complex nr2f2el506/+ ; nr2f1ael512/el512 nr2f1a, nr2f2
nr2f2el506/el506 ; nr2f1ael512/el512 nr2f1a, nr2f2
nr2f5el611/el611 ; nr2f2el506/el506 (TU) nr2f2, nr2f5
nr2f5el611/el611 ; nr2f1bel523/+ ; nr2f2el506/el506 (TU) nr2f1b, nr2f2, nr2f5
nr2f5el611/el611 ; nr2f2el506/el506 ; nr2f1bel523/el523 (TU) nr2f1b, nr2f2, nr2f5
la116Tg ; nr2f1ael512/el512 ; nr2f2el506/+ nr2f1a, nr2f2
nr2f1ael512/el512 ; nr2f2el506/+ ; zf13Tg nr2f1a, nr2f2
nr2f1ael512/el512 ; nr2f2el506/el506 ; la116Tg nr2f1a, nr2f2
nr2f2el506/+ ; sd12Tg ; nr2f1ael512/el512 nr2f1a, nr2f2
nr2f2el506/el506 ; sd12Tg ; nr2f1ael512/el512 nr2f1a, nr2f2
zf13Tg ; nr2f1ael512/el512 ; nr2f2el506/el506 nr2f1a, nr2f2
edn1tf216b/tf216b ; nr2f1bel523/el523 ; nr2f5el611/el611 ; nr2f2el506/+ (TU) edn1, nr2f1b, nr2f2, nr2f5
nr2f1bel523/+ ; nr2f2el506/el506 ; nr2f5el611/el611 ; edn1tf216b/tf216b (TU) edn1, nr2f1b, nr2f2, nr2f5
nr2f5el611/el611 ; nr2f2el506/el506 ; nr2f1bel523/el523 ; edn1tf216b/tf216b (TU) edn1, nr2f1b, nr2f2, nr2f5
nr2f5el611/el611 ; nr2f1bel523/el523 ; nr2f2el506/el506 ; nr2f1ael512/el512 (TU) nr2f1a, nr2f1b, nr2f2, nr2f5
nr2f5el611/el611 ; nr2f2el506/el506 ; nr2f1ael512/+ ; nr2f1bel523/el523 (TU) nr2f1a, nr2f1b, nr2f2, nr2f5
nr2f5el611/el611 ; el10Tg ; nr2f1bel523/+ ; nr2f2el506/el506 (TU) nr2f1b, nr2f2, nr2f5
nr2f1ael512/el512 ; fb2Tg ; pd42Tg ; nr2f2el506/+ nr2f1a, nr2f2
nr2f1ael512/el512 ; fb5Tg ; nr2f2el506/el506 ; pd42Tg nr2f1a, nr2f2
pd42Tg ; fb5Tg ; nr2f1ael512/el512 ; nr2f2el506/+ nr2f1a, nr2f2
pd42Tg ; nr2f2el506/el506 ; nr2f1ael512/el512 ; fb2Tg nr2f1a, nr2f2

CITATIONS  (2)