ZFIN ID: ZDB-ALT-180606-9
Genomic Feature: el512
Synonyms:
Affected Genomic Regions: nr2f1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-nr2f1a
Lab Of Origin: Crump Lab
Location: Chr 5: 49745891 - 49745898 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted from position 1119 to 1126 in RefSeq:NM_131180.1 in Exon 1 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
GAATTCGCGCTGCCGTTCGTCCAAGACTTCCCTTTTCCCTGCTCCGATATCCGAGCGACCAGTTCGCTTGAAAGCACTTTTCGGGCCCGAGATATGGCAATGGTAGTTAGCGTCTGGCGAGATCCGCAGGAAGACGTGGCTGGAGGACCTCCGAGCGGCCCCAATCCAGCAGCTCAGCCGGCGAGGGAGCAACAGCAGGCGGCGTCAGCGGCACCACACACTCCGCAGACCCCCAGTCAGCCAGGACCTCCGTCCACACCAGGGACGGCTGGCGACAAGGGCAGCCAGAATTCTGGACAGAGTCAACAGCATATAGAATGTGTTGTTTGCGGGGACAAATCAAGCGGCAAGCACTATGGTCAATTCACCTGCGAAGGATGCAAAAGTTTCTTCAAGAGGAGTGTCCGAAGGAACTTAACATATACATGTCGTGCCAACAGGAACTGTCCTATTGACCAACACCATCGTAATCAGTGCCAATATTGTCGGCTGAAGAAGTG
TTTAAAAG/-
TGGGCATGCGGCGGGAAGGTGAATATATTTTTCTGAATACATCACACTTGCTACACAAACAGGTTTATTGTTTAAAGCAAGGTTATGCAGACCTCGCAATATTAATATGCAAACGCAAAATACTATCGTATTGAATTATTGCTAAAGAGTGTCAGAGGGCGCGTTTGTAAATACACGCGTATATATGCAAGATCAGCATGGATCTATTATAGTTTTTTTTACATAGATTGGCAAATATCGTATGCACCAATTTCAACTCGCAAATAACAATATATATTATAAAGTCACCCAGTAAACACTGTGTGTGTCAAAAAGAAAGATAAAGATTAAGTGTGTAGCTAAGCCTACGTGCTTTTACGTGTGTGCTGAAAGACGAAAAAGCTAACTACGTTCACATGCACATATAGTGTACCCTATTGAAATAAGAAGCTATAGCCTATGTTTATCTCTCGAAGTAAGATGTACAAGTCTGTTTTCACGCCGTAGCCTAGAGTAAACGT
OTHER el512 PAGES No links to external sites

CITATIONS  (3)