ZFIN ID: ZDB-ALT-170626-1
Genomic Feature: ya324
Synonyms:
Affected Genomic Regions: mir24-1 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR1-mir24-1CRISPR2-mir24-1
Lab Of Origin: Nicoli Lab
Location: Chr 10: 15960841 - 15960842 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 25 bp inserted / 2 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TTTTTTTTATATAAATATGAAACCCTTTTCTAGTGAGCATGTGCTGAGTGCTTATGTTTACGAATAATGTCAAACGGATTACATATTAAAAAGGTATGGAGAGCAATTGTGGCTAAGTGAAGTTTATTTATAAACTAATTTCGAAAGAAGCACATTCTTATGATTATATATACTTTTGAAAAGGGGGCTGGGAGCAAAATCTCATTTGAATTAAAAGCGACAGTCTCCAAAAATGGCACAATTTAGATCAAAGACTTAAAGGGGCAGTTTCAAATTTATTTGCAGGTTATTTTGAAATAAATCTTCACATACACACTCTAGGGACATCAGTTAATTCTTTTACATCATGTAAAATCTACATAATAGGTCCCCTTTAAACTGAAAAGCCCATGACCAAGGTAAGAGTTAAGGTTTCTAACTTACCCCTTTCTTTCCACACACCTGGTCATCTGATGTCAGCTGATAATCTGTTTGGAGTTGTGTGTCTCATCAGGACCTGA
GC/TGAGAGCTGATATCAGTTATATCAG
TCCGGTGCCTTCTGAGCTGATATCAGTTGTAGTAAATCACTGGCTCAGTTCAGCAGGAACAGGAGTGTGGCCCCTCCACAAAGAAGCACACATTCTGGAGCGTTCAAAGGCCAAAGGAAAATGCTTCTGGAAAACCAACGAACATTAAGAAACAAGTCTGTGCTTGATGTGTGTTTGTCTCAAAATGAATGTCCTGAAATGCCTCGGCCTTAAATGAACCAGGAGGGCTGGTTTCCCAGACACAGATTAAAGCAAAGTCCCTTAATAAAAAGATTTTTTTTTTCACAGAGAGGATCAGAATTCAGGTGACTGGACTTGATTACACTGTAATGACTTCAGAAATATTTGACAATAAAGAATTTATTTGTTAGGACTCTGTCTCTTATTTGTATGCTTTGGATTTACTTCATTCGCTTGAGTAAAGAAAAAAGTTAAGCAGTGAAATATGCAAACATCTTTTTTGCTCTAATTAACTAAATTAATGACACTGTAAATTTATC
OTHER ya324 PAGES No links to external sites

CITATIONS  (1)