Genomic Feature

nju49

ID
ZDB-ALT-170113-7
Name
nju49
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Zhao Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
As compared to the WT sequence, 107 bp is deleted (contain all exon 1)
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 25: 25506480 - 25506586 (GRCz11) (1) Details
Nucleotide change
AAGCTGGTTAGCCGCTGTCACACGCACAGTGGAGTGGAGAATAGGCGCAATGTGCGTTAGTCAGTGGCTTACCTGCTTTCAGAAATCACAAGTTCCGATGGCACAGG/-
Variant Notes
As compared to the WT sequence, 107 bp is deleted (contain all exon 1)
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
107 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AAAAAAATCTGTCACACGAATAAAACAATGATATATGATTCGAGGTTAAACTTTTAAAGTGACACTTCGACAGCCTCTGTAATTTGCGTAGCTTGAAGTTCAAAAGTTCAGAGTTGGTTTCGTGAAAAACAACATTATTGTACAAACAAGACGAAGCAAAGCAACTTAGTCAACAAGTTTAATCCTTTGTGAACCAGACTGCACATGATCACATTTACACTGTATTTCTAGTGACACTGTAAGCAGGCTATTTTCTTAAAAATGTACATGTACACCGATCACACAACGCACCCATTTATTCAGGGCATGCGCTCCGCGGGGATTGAACGCACCACAGCCCTAAGTTAGTGTTTCAAGTGCAGTGCTTTACCAAGAACAAAAAGTCATGTTAGAGGGACAGTGGATCCCAAAGCGTCCCTCCGGTGACTGTGTCCGCCTTGATCCTTTAAGTAGTCTCCAGTGGGACATTCCCACGGCGCTGATGTCAGGTGCAGATCCAA
AAGCTGGTTAGCCGCTGTCACACGCACAGTGGAGTGGAGAATAGGCGCAATGTGCGTTAGTCAGTGGCTTACCTGCTTTCAGAAATCACAAGTTCCGATGGCACAGG/- AAACGGTGGAAACCCAGAATATCGCTGTAAACATGTGAATAAAAATTATCATTTTTTATAACATGCCGTTCTGCAGCTGAACATTAGCAAAATATAATGTAGCCTACAAGGATAATTTATTGTAATATTTATAATACATTTTAATAATACGATTATATTTTAATATATGATGACGATATAATATTTAAGATAGTTAGGCCTTTATAAAGTGATAACTTATATTCAGCGATCATGTATGGATAAAATGTCTTAATATCCATTAAATAAAATTATTTACTCATCCTGAAATTACTATGGTCTCTCTCTCACATATACACGCATACATATATGGTATATATGGGCTAATATGAGCAAATATATCGATTTATACAAAAAAGTAAATAAGAAAATAATAAGATATTTAGAGATAACACTATGCAAGCATATATGTATATACATTTTTTAAATCAACTGATTAATAATATTTGACAGTAAAAAAAGAAGCAAAGAAAAAACACACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations