Genomic Feature

sa7440

ID
ZDB-ALT-161003-18970
Name
sa7440
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Stemple Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 17: 44748792 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Missense (1)
Protein Consequence
None
Sequences
Flanking Sequence
CACTGTTGACCATCCCTTACACCTTAACCCACCCTTAAACCTACCCATGCCACCAAACCTGTCCATAACCCAACCTCTATCCCAACTCAAAAGCACCACAAGTGTTCTCAAATACATTATAAACACAGTAAGTACATTGTATTTATTTTTTTGATGTAAGTACATAGTAGTTAGGGACACTTAATATAAATTGGGACCGTACTTCCAACTGAAACAGAATATTGAGTAGGGGGCGGGGCTTTCTTTTTGCACATCATTGGCTCGAGTAAACCAACACAAAAATACAGTCATATAAATTACAGGAAATGTGGAAATATAAATAAAAATTGCATCACTGATGTTGGATGGGTTTTCACTAAATTCAAAAACTTTGTTTGTCAAGCACGTAGTTGGGGTGGATATTAATAATATTATGACTTTTTCAGTTATTAAAGATTAAGCCAGCAGAGCAGGGCCAGGAATATGTGGAGATGACCTTTGTGGAGCACAAAGCCTGTGAA
T/C GTAGGTAAGGGAAAACATCTATTCAGTTTATGTAAGCACTGTGTTTTGCATTGCGATGCAGCTTTGGGTTGTCATTATAAATAAAAGTATTAAACATAAATGAGGAATAAACTGCATGCTGAACGGAAATAGAGGTGTTTTAATAGTCCCTTTGCTTTCTTTTCTTTTACATTGTGATTCCAAGACTAAGAAAACCTACAACAAAACAAGACAGGTAACAAGTTGTGCTACACTTACGCATTTTTGTTAATATAGGATATAGACTAAATGGAGTAATTGTTTCTTTTGTTGTAGATGGAAACCCAGAAATAGAGGGAGAAAAAGGAAGGAGAAGCAGAAAGCCAAAGACTGTGACCGGTAAGTAAAGCGTCTGCTAATAGTTTACCGTATATTAGCATTCAGCTAAGCTAACAATGCTTATCACACTTACTGACCTTTCAAAATATCCAAGGATATAAATAACATTTCTACAATTTTCATGAATAAAAGAAATATAATAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations