Genomic Feature

s981

ID
ZDB-ALT-160812-4
Name
s981
Synonyms
  • bns981 (1)
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 21: 7246661 - 7246665 (GRCz11) (1) Details
Nucleotide change
GGCTG/A
Variant Notes
This mutation is the result of a 4 bp deletion and 1 bp insertion leading to a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp inserted / 5 bp deleted in Exon 3 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
ATTATATGCTGTCATGGCTTTGCAATCAAAAAATGTCAATATAATGGAAGTCAATGGGGAAAACAGTCAGTAGCATAACAAAAGAGTAGTCAGTTTAAACAGTACACAAGGGTTAATATACATATAAATGCATTTGGTCCACTTTATTTAATGATTTCTATCACAATATGAAGAAAAGACATTCAAGCAGCATAACAAAAAAAAAAATCTGAAGACAACTATCGCACCTTTAAATCGATATGACCTTTGATTTACCTTGGTTGCAGTTGTGTGAATGCATGCGCCTCCACCCCGGACAGCATTCTGGGTAAATTTGTAGATTAGGAGCTGCTCTGCTCACCTGCCTATAAGAAACCTTGTAGATGGTCCTGTAAAACACGCAATACAGTGAGTTGATGGTGCATGGTACGGTTTTGATATGTGTTTTCCTGTGCTGTTCTTACTTGTACGTGCTGCACATGCGGTGGTTTTGGCACATGGTGATGTAGGGTTTGTGTACA
GGCTG/A AAGAAAAGACTCTGTGCTGTAAGACACGCGACGACTCCAGACATCACCAACACACACTCTCCTCCTGAAACACACACATATAAAGCGGGGAAATTAAGTATTAAACACGTCACCATTTTTCTCGGAAAACATATTTCTCAAGGTGCTGTTGACTTCCATATTTGCAAAGAAAACTAATCTTATTACAAATTAAGTAATGCATAATAAGATGAAAGGACGCAGGGAAAAAGTATTGAACACATGAAGAAAGAAAGGTATAGAAAGGCAGTGAAAGCCCAGACAGCAGCTGAAATCTTTCAGTAGTTCTTCAGCAACCCTCTGCCCTGCCTCATTGTAAAGTAATATTAGCTGCTTTAGTCCAACATCTACATTAGCAGGATGATGAAGATGAAACCAGAGTGGACATTTCAGCAAGACAATGATCCAAAACACAACCAAGGAAACTCTCAAATGCTTTCAGAGAAAGAAAATTAAGCTGTAGAATGGCCCAGCCAATCACC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations