Genomic Feature

um158

ID
ZDB-ALT-160721-16
Name
um158
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Lawson Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 22686841 - 22690046 (GRCz11) (1) Details
Nucleotide change
ATTTCTACCTCTGTCTATCACATGTGACAGGAAACTGACCTCTGCATTCTCAGAGGGTTTAAAAACTCCTCCATCACCACTGGTACAGACAGATTAAAATAGAGAAGCAAAATCATCTCTACCTCAGCTACCACATCCTCTGTTTTTCCCACTCTAGTTTTTTGTAACTGTAAACTGCTTGTCTTTATTGTGCACTGAACTCTACTAGTATTCAAAAACCACCCAAATGCATGACTCACACTCATAGATGTGCAGAACAGCACATACAAGCTTGGTCTTCTTCAAACAGGAGCATTTGATACGGCTAAAACATGCACATCATTCACGAGCTCCTGATCCATAGAATATTATTTTATTGATCAGATTATCTATGGCACAGTACATCTAGTATGTAATCATGTATCAATACAAAAGCATTTTCCTTTGCACAGAAACAACGTGTCTGACACTGCACTCAAATCAGAGAGAAAACACACACACACGCACACTCATTATTTGTCTGTTTATCCTCCCTGCTGTCAGAAAGGAGGAACTGTAGTGAAAAAGTGTCCAAATATCTGCGAACTGCCTGTTCCCATAAGGTCCAGAATTTGAAAACTGCAGATGGGTTTCAGAGTCTATCATTCTTCTCTGTTAATTCTCTCTTAATAGAAAAATATTTCATACTTCCCGTTTTTCCATTTTATTGCAGATTTTTTTTTCAATTGGTGGGCAAATTCTGAAGGAGATGTTCTGTTGCCCTGTGACGTTCTTGTTTGTCCAGTAGGGTCTTTCCCTATGTGCATCCTTATAATCACAGCCAGGCAGTGCTCGATGTAATTTCAGTTGCTGGGGAAACATACTGTCCTTTGGCTGGTGACCACATCCTGCAAGGATGCAAATCAGGTGTATCCATGATTCGTTCTCTTTATGTCCAGAGATCTGTTTTGAACTGACATCCATTGCGTTTGTGTATATCCGAATAGGTCAGAGGTCAAAGAGTAAGCGTCACTGTCTCTGACTGACGCTGCCCAGTGTCATCTTCCACCATCTTCTCTGTAAGACATCAACCCTGCTGTCATATCTTCGTCGGACCCCACCCCTCACCTCATCCACGTGTGGATCCTCCTCACAGAGTTGTGTAGATGTAAACAAACACAATGACGAAGAGGTTCAAGAAGGTGCCTATGATCCCCAGAAGGGCCAATATGGACTCCTCTCGCTCCTCTTTACCCTCTTGCGCCCGAACCTCCTCTATACTGACAGTGGTCGTCCCCATTCTGACCCCCCCACCTCTGTCTCCAGGGTGCTTATCTGTGGAGAAACAGGAGAGCAGCATGAGATGATATTTAATCAACAAGGAGTGGAAGCTTCTGTGGTTCCATCCAACACTTATGTTCTCAGATGGCCACCAGTAGTGCTCATCCAGAGGCCAGACCAAACACTCAGTGAAGCAACTCCGAGGGTGAGATTTCCCTCTACACTGATTGCCCAGCTGCGAGTATGGCGTAATGAACACAAAAGAGGATGTCTCCCCCTCACCTCAGTGATGGATTTCCCCCTCAGAAAATGATATTTCCCTGCGGAGCTGCTACAACAAGGCGACTCTTGGCAGCTGAGATGATTTACTATCCATTTAAGCCATCTCACTTGCTGTTTGCCTCTGCCATGCACACTAAATGATTTCTCTTTTCTCATCCCGTCCTTCCTTAGCTTACGGTTTAGCTTGGTACCATGTTCATTGGAGCACATGTGGAAGTGTCTGCTTCCAGATACCAGAACATTCATCTCAATGAACATCATTAAACCCTACAACTCAGCAATGTGGACAACAAGCCTTGTAGACAGTCTGACACATACAGTGGAGGGAACACTAGACAAAAGCAAGTACAATATGAAAATAGGGAGTCTTACCCTACGGCGTGGGAGATCTGGGGGAAGATCCAGCATGCTGTGGTCTCATCACAGGAGATGCATATCTGGGCTGGCGGCAACATGAGGGCCAGGTGGCCAAACATCCGATATCCCCAAGACCGTAAAGAAGGAAAAAAGAGAAATTGAGAGGTGGAGAGAGAGAGAAGGTCTACAACAGCGTCTCCTTGAGCCGTGTGCGTTACGCAGACAACAATCTCAGTCCCCAACGTCCCTCCCCTTCGCTCTCCCTCTCTACCTTTCTTTCTCTCTTTCTCTCCCTCTGGCTTTCTCTCGCTGTTTCTGTGTCAGTATTCCAGCCTCCTTACACATCACCAGCCATTCCTTTTGTTCCACGCTCATTCAGATCTTCATTTATTCTTCTTCTCATGGTTGTTTATTTATTTTTTTGTTCTTTGCTTGGACGCCTCACACCTTTCATTCAAGCGGGGCTCGGAGAAATCCGCTCCCTGCTCTCTTCCCCCCCTCCCTCTCCCTCGTTCTCCTTTTCCTTTTACCAAAATCCTCCTTAAAAAATCTCCTAGTCTCCCCTCCTTTCTCTCTCTTCCCTCCCTCTTGCTGTCACACTCTCTCGTTCTCTGCTCTGTCACTCTTGTCTATCTGACCCTTTTAGCATGTGAAAGTGAGGCGTCTCAGCATTTGTAGAAAAACTGGCCCCCACCTTCTCTCCTTTCCCTCCTCCGTGATTTCTTTCCCTCCTTTTGCGCTCCGCTTTTTCTGTGGGTGTAGAAGCCCTACAGATGTGCGTGGATGCCTCCGGATGCTCGGGAGATTGGCGATCTGTGGCTGCGAGCTCCCCACCCTGCCGTTCTCTGTCCGTAGCCGATGGCAGTCGTGTGGTTATAGGTCCCGTCTCGGAGCCTGAGAGCGCCGTGCATTGCATAACCAAGCAGAGCGACTGGTAACCGCGGAAACCGAGCGAGGGAGATCGGGAGGGTGGGCGGCGAGGAGGCTCACACGTCAAATGTCTTTATTGCCAAGAACAATGTAGAGCCACAGAGAGATGAGGAGCAGAGAACGATCCAAATTGAGAGTTGTGGAGCTGGGTCCTTTTCTTCTGAGTATTGATGATCCCATTGATCTCACAGGGCTTTTTTTCTACAAAAGACAGTCATATTTGGGAATAATGTTAAGCTATTAAATGCCTGTGTGTGAAAGGACTAATGTGTACATGTGCATGGGTGTCCAAACCATGTATTCTTTCATACTAGAGTTGTACAAATAAGGGTACCTTCTAATCTCTTTACTCAATCTCTTGTATATGTAGAGGCATCCATTGTTGTTGTAGCTAGCCA/-
Variant Notes
Deletes entire transcript.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3205 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ACCTTTAAAACGCATATACAAGTTCTTAATAAGCTATGAACTAGTTTTGAGGGTTTACACTGATCTGAGAGTGGGTTGTAAAGTGTTCACACTGATCTGAGTGGAGGTTGAGAGATTGAGGCTGGTTTGAGAGCTGGTTTACACAGAGCCGTTGTGGTGGGGATTTGTATTTGATGATAAGCCCTGCAGGTACATGCTGATTTACAGGGTAGGCCTTTATTACAGCAGTGCCCTGTGGCTTTGGAATTTATTGAGGGACCTGAGACTAAGCGCAAAGCCCTGCTAACATTTCTGCAGGCAGATTTTTCTGAGCACACTTCAGTCTGACGTATTGCAACACACTTGGGTAGAGGGCAAACAGTGTTGCTATGTTTTCCTTGCAAAGATCTGCCACAAAAGCTCAATTTCATGCATGTTTAAATTGGTATGTGTGTGACAGTCGTGGGCTCTTTAGGGCACGTTCTGGTGCCTCATTCTCATTCATGAAGCTCCCATCAGCC
ATTTCTACCTCTGTCTATCACATGTGACAGGAAACTGACCTCTGCATTCTCAGAGGGTTTAAAAACTCCTCCATCACCACTGGTACAGACAGATTAAAATAGAGAAGCAAAATCATCTCTACCTCAGCTACCACATCCTCTGTTTTTCCCACTCTAGTTTTTTGTAACTGTAAACTGCTTGTCTTTATTGTGCACTGAACTCTACTAGTATTCAAAAACCACCCAAATGCATGACTCACACTCATAGATGTGCAGAACAGCACATACAAGCTTGGTCTTCTTCAAACAGGAGCATTTGATACGGCTAAAACATGCACATCATTCACGAGCTCCTGATCCATAGAATATTATTTTATTGATCAGATTATCTATGGCACAGTACATCTAGTATGTAATCATGTATCAATACAAAAGCATTTTCCTTTGCACAGAAACAACGTGTCTGACACTGCACTCAAATCAGAGAGAAAACACACACACACGCACACTCATTATTTGTCTGTTTATCCTCCCTGCTGTCAGAAAGGAGGAACTGTAGTGAAAAAGTGTCCAAATATCTGCGAACTGCCTGTTCCCATAAGGTCCAGAATTTGAAAACTGCAGATGGGTTTCAGAGTCTATCATTCTTCTCTGTTAATTCTCTCTTAATAGAAAAATATTTCATACTTCCCGTTTTTCCATTTTATTGCAGATTTTTTTTTCAATTGGTGGGCAAATTCTGAAGGAGATGTTCTGTTGCCCTGTGACGTTCTTGTTTGTCCAGTAGGGTCTTTCCCTATGTGCATCCTTATAATCACAGCCAGGCAGTGCTCGATGTAATTTCAGTTGCTGGGGAAACATACTGTCCTTTGGCTGGTGACCACATCCTGCAAGGATGCAAATCAGGTGTATCCATGATTCGTTCTCTTTATGTCCAGAGATCTGTTTTGAACTGACATCCATTGCGTTTGTGTATATCCGAATAGGTCAGAGGTCAAAGAGTAAGCGTCACTGTCTCTGACTGACGCTGCCCAGTGTCATCTTCCACCATCTTCTCTGTAAGACATCAACCCTGCTGTCATATCTTCGTCGGACCCCACCCCTCACCTCATCCACGTGTGGATCCTCCTCACAGAGTTGTGTAGATGTAAACAAACACAATGACGAAGAGGTTCAAGAAGGTGCCTATGATCCCCAGAAGGGCCAATATGGACTCCTCTCGCTCCTCTTTACCCTCTTGCGCCCGAACCTCCTCTATACTGACAGTGGTCGTCCCCATTCTGACCCCCCCACCTCTGTCTCCAGGGTGCTTATCTGTGGAGAAACAGGAGAGCAGCATGAGATGATATTTAATCAACAAGGAGTGGAAGCTTCTGTGGTTCCATCCAACACTTATGTTCTCAGATGGCCACCAGTAGTGCTCATCCAGAGGCCAGACCAAACACTCAGTGAAGCAACTCCGAGGGTGAGATTTCCCTCTACACTGATTGCCCAGCTGCGAGTATGGCGTAATGAACACAAAAGAGGATGTCTCCCCCTCACCTCAGTGATGGATTTCCCCCTCAGAAAATGATATTTCCCTGCGGAGCTGCTACAACAAGGCGACTCTTGGCAGCTGAGATGATTTACTATCCATTTAAGCCATCTCACTTGCTGTTTGCCTCTGCCATGCACACTAAATGATTTCTCTTTTCTCATCCCGTCCTTCCTTAGCTTACGGTTTAGCTTGGTACCATGTTCATTGGAGCACATGTGGAAGTGTCTGCTTCCAGATACCAGAACATTCATCTCAATGAACATCATTAAACCCTACAACTCAGCAATGTGGACAACAAGCCTTGTAGACAGTCTGACACATACAGTGGAGGGAACACTAGACAAAAGCAAGTACAATATGAAAATAGGGAGTCTTACCCTACGGCGTGGGAGATCTGGGGGAAGATCCAGCATGCTGTGGTCTCATCACAGGAGATGCATATCTGGGCTGGCGGCAACATGAGGGCCAGGTGGCCAAACATCCGATATCCCCAAGACCGTAAAGAAGGAAAAAAGAGAAATTGAGAGGTGGAGAGAGAGAGAAGGTCTACAACAGCGTCTCCTTGAGCCGTGTGCGTTACGCAGACAACAATCTCAGTCCCCAACGTCCCTCCCCTTCGCTCTCCCTCTCTACCTTTCTTTCTCTCTTTCTCTCCCTCTGGCTTTCTCTCGCTGTTTCTGTGTCAGTATTCCAGCCTCCTTACACATCACCAGCCATTCCTTTTGTTCCACGCTCATTCAGATCTTCATTTATTCTTCTTCTCATGGTTGTTTATTTATTTTTTTGTTCTTTGCTTGGACGCCTCACACCTTTCATTCAAGCGGGGCTCGGAGAAATCCGCTCCCTGCTCTCTTCCCCCCCTCCCTCTCCCTCGTTCTCCTTTTCCTTTTACCAAAATCCTCCTTAAAAAATCTCCTAGTCTCCCCTCCTTTCTCTCTCTTCCCTCCCTCTTGCTGTCACACTCTCTCGTTCTCTGCTCTGTCACTCTTGTCTATCTGACCCTTTTAGCATGTGAAAGTGAGGCGTCTCAGCATTTGTAGAAAAACTGGCCCCCACCTTCTCTCCTTTCCCTCCTCCGTGATTTCTTTCCCTCCTTTTGCGCTCCGCTTTTTCTGTGGGTGTAGAAGCCCTACAGATGTGCGTGGATGCCTCCGGATGCTCGGGAGATTGGCGATCTGTGGCTGCGAGCTCCCCACCCTGCCGTTCTCTGTCCGTAGCCGATGGCAGTCGTGTGGTTATAGGTCCCGTCTCGGAGCCTGAGAGCGCCGTGCATTGCATAACCAAGCAGAGCGACTGGTAACCGCGGAAACCGAGCGAGGGAGATCGGGAGGGTGGGCGGCGAGGAGGCTCACACGTCAAATGTCTTTATTGCCAAGAACAATGTAGAGCCACAGAGAGATGAGGAGCAGAGAACGATCCAAATTGAGAGTTGTGGAGCTGGGTCCTTTTCTTCTGAGTATTGATGATCCCATTGATCTCACAGGGCTTTTTTTCTACAAAAGACAGTCATATTTGGGAATAATGTTAAGCTATTAAATGCCTGTGTGTGAAAGGACTAATGTGTACATGTGCATGGGTGTCCAAACCATGTATTCTTTCATACTAGAGTTGTACAAATAAGGGTACCTTCTAATCTCTTTACTCAATCTCTTGTATATGTAGAGGCATCCATTGTTGTTGTAGCTAGCCA/- ACATTCTGGGCTGTTCAATTAATGTCGTTTATCTTCGACTACCCTTTTCACCGATTCTTTTTGAAGTTTTGTTCTCATCC  ...
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations