Genomic Feature

hu5855

ID
ZDB-ALT-140801-1
Name
hu5855
Synonyms
  • lyc1 (1)
  • lymphatic and cardiac defects 1 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Schulte-Merker
Current Source
Other Pages
Note
mutation in pkd1a introducing a premature stop codon (R3607X). This mutation was predicted to result in the failed translation of six of the 11 transmembrane domains and essential C-terminal cytoplasmic tail of the protein
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 54303972 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
mutation in pkd1a introducing a premature stop codon (R3607X). This mutation  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Arg>Stop at position 3607 (1)
Sequences
Flanking Sequence
ATTTACTAAGTATGAAAAAACAATTATTAAGCACATTTTAAATGTGGTTATAAGTCAAGAATAGAGCATTTGTAGCTGCAGTTATAAACTGCTTACTAACGTTTATTAATGTAGAGTTAATGCTTAACAGATAATGAATTCACTATTTGCTAATGCTTAATAAATGATTTATAGTGTGTAGTTATTATAAAGTGTTACCAAATATTTGTTTTACAGCTCTATTTGCTGAAATAATAAAACTCCACGATGTTTAAAAATGTGTTGAAAAAAATCTGCTTACCGTTGAAGAGAAATTGGGGAAGAATATATACAAGCGGGCTCATAATTCAGACATCAACCGTCTGACATCAACGTATATACCATGGTAAAATGAATGAAGTGGTGCAACCGCGGTACCTTCAGCATGGTGTGCAGCAGACGGACTTTACGCGCCTCTTCTCTGGCCTGTGAGAGAGCGAATCCCTGCGGCGGGCGCACTCGGGGGATCCGCTGGACCACTC
G/A CTCCACACGCGGACACTCCACCAACACATCCTGCTCCTCAGGCCGCAGACGCCGCACCACCAGAGAGAAATACACACCCTCCAGCAACACCTAAACACACACATCGCAGAGTTACAGAACACACAGGAATAGCAAATATGGACATCTGGACATTTCAAGTGCAATTTTTAAAACAACAAACAAAATACAATACAACACACTACCTGACAAAAGTCTTGTCAACAACAAATAATATCTTGACTTCTAATTGATTATTTGGTATCAGAAGTGGCGGTCCCACTTTATATTAAGTGGCCTTAACTAATAAGTACTTACACGGGAATTAATAGTTTGTTGCAATGTACTTATTGTGTAAATACATGTATTTACTGTGTATTTATGCTTGATTAAATACCCGTATGTAATTACATCTGTTATTAACTATTGTAATTACATTTGTAAATACACTGTTGGTCATCCCTTACACCTTAACCCACCCTTAAACCTACCCATACCACCAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations