ZFIN ID: ZDB-ALT-110802-3
Genomic Feature: hu4800
Synonyms: wickham (1), wkm (1)
Affected Genomic Regions: cemip2 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Bakkers Lab
Location: Chr 5: 25781558 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A at position 1277 (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Val>Glu at position 426 (1)
FLANKING SEQUENCE (GENOMIC)
TAGCAGTATAACCAGACTCAGCAACTGGTGTGTGTGTCTGTGCTGCTTGTAAAGTCTATGTAATCAGTTCATAATGATCCTCCAGCTGTGTGTGAAACAGGAACAGGTGTGTGGGTTTGGTGCGTCACAGGATTTATAGTTCTTTTGGTGGCAGATTTGCAGTTCTCCAGCGATTTGTATGGACTAGGTCACTGGTGATTGTGACAATAACAAACAGCAAATGTCAATTTTTGAGTTTGTGTATTTTATGTGTTTGAGGTAAAACTTGGGCTAATTTGCATTTAAATAAACAAAAACAAAAATAAACAAAAGTTTTTTTTTCTTCTCACCTAAAATGTTGTGTTTACAGTGTGGCGTAAGGATCTGTGAGTACATGAGATGAAAAAGACAAAAAAGAAAACCCTTTTTAAACCTTCACTGTTTTTTGCCATAAGGTTACCCTACTACAGGCTTCCAAGTGGATGCAGTGGATAAAGTAGTTCTGAACCTGCAAGATGACG
T/A
GAGCAGCTGGAATCCGGGTGATCGGATTGTGGTGGCTAGCACAGATTACTCCATGTACCAGGCAGAAGAGTTCACCCTGCTCCCCTGTCCAAACTGTAACAGAAAGCAAGTTCAAATTCAAGGTGAGATGGCTTTGGTTTGTTGTGTTAATAATTTACAGCATCTCTGCTCTCAATCTTGCTGTCAATTTTCATGAAGCCAAGTTGACAGTGTCTATGAGTTTGCAACAGGAAAAGGGTGAGGACTGTTTACCAGAGTCCCATAAACAAACTTGTCATTTTTGACCATAGGCCAGCAGTGGCTGTATAGATAATTCTTCCATCATGTTCTCCACCCTGTTCAAAATTCAGATTTTTTGTCACTAATTGCTTTACAGTGATAACGTCCCAACTGCTCTTTAGGGTGTACTGGAATTTGTACACATACATGTTTGTGTATGTGTTTTCGTTAGATAGAAAGAAATCTCTTATGCTGATCAAGGCAGCATATAATTAATTAAA
Comment Citation
GTG>GAG, at 1277bp from the predicted start ATG De Angelis et al., 2017
OTHER hu4800 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cemip2hu4800/hu4800 (AB/TL) cemip2 ♀+/- ♂+/-
Complex cemip2hu4800/+; cemip2hu5935/+ (AB/TL) cemip2
cemip2hu4800/hu4800; la116Tg (AB/TL) cemip2

CITATIONS  (5)