ZFIN ID: ZDB-ALT-061207-8
Genomic Feature: st23
Synonyms:
Affected Genomic Regions: kifbp
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Talbot Lab
Location: Chr 13: 23087161 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A in Intron 5 (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
GATTTTATTTTAAACTAATACCTTTATTCAGCAAAGTGAAAAATTCAGTCTTTAAAAGTGACAATTAACACGTTTATAGATATATAGGGTTTCCCAAAAATCAATAATCTTCAAAAAACTATACTAACAAAATATTGTTCACAGTCAATAAACGTTAGATTTTGACATATTTGACCAAAAAAAAGGCCTCTTCCCTCTTGTAAAATATGTAGGTTTTGTACAACCTCAGGATCTGGTGCAACATAAAACAACCGCATACATGAGTGTTACAATAACAGACGGACTGGCCCAAACGCCACTGTTTCAGAAGAATTACAATCAAAAACAGTATCATTACAGTGAAAGTTTCACTATGAGTTCACTAGGGAACAGACTAAAATTAGGGACTTCTGTTTTCATTTATCAACCTCGGCACATCATACAGAAAAGAAAAATGCCGGGAAATACACAATATCCAATAATATAAAAGAATGTACAGTCAAACACCAGATCGAAACTCA
C/T
TTTCTTTGGCAGCTGCCTCTGAGGGGATTTCTCCAGCAAGGTTAGCGATGACACTGGCAGCAGCCAAACAATGACGAGCCTCCATATATCGGGTCTATGCCATAACAAAAACAGAGAGATACCTCAAATTATTTTGAACATGATCAAAATGTCATGATACCTAAAAAAAACTAACTGGCAAAAATATATATATATATTATCTATAGGCACAGTTGGTCGTTTTAGCCACTAGAGGGCAATTATTCACAAGAAAACAACGGCAGTTTGATGATGTAATTGAGCAGGGAATCATGGGAGTTGTCACATTCATTACATCCTACAGGACTTATTATAATGCTTGTAATTTGTATTTAAAAAAAAAAAGTCTCCATAAGTTAAACAGTTGATGAACCATTTTTGAATACATCCAGCCAATTACCCAGTTAATGATTTTTGCAATTTGCACAGTATTTAACTGTAATATGAACTGTAAGAAACTATAGGCAGTTATGCAGTATGTT
(1)
Comment Citation
This is a GT to AT mutation that disrupts the splice donor at the begining of  ... Lyons et al., 2008
OTHER st23 PAGES No links to external sites

CITATIONS  (11)