Genomic Feature

s9

ID
ZDB-ALT-000621-2
Name
s9
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 43717424 (GRCz11) (1) Details
Nucleotide change
A/G
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Val>Ala at position 104 (1)
Sequences
Flanking Sequence
ACATCATGAAGTTACTCTGAGATGGCAGAGGAGGAATGACCACCTTCATCTCCGGCCCGATGGTCTTGTTAGGAGGGAAGTTGTCATACTCCACCAAAAACTGCTTCATTGTTGATTTAGCGTGGTTTGCTGAATGTGTGAACTGTTCGTGTTCCTTTGGGTACTGCTGTGTGTAACTGCGCGGCACCACCACACTCAGGTGATCAGTTTTGATGGGATTCTCCTGGGTTCTGCTGAACATGCATGGGATGGTGGTTGGGTCGTATATGTCACCTTTAATGGTGCTGATTTTCTCCTCTGAAGAGTTGATGAGCTGCTGATGGAAGCTGTCTGCTGTAAATGTTGAGGTTCTTTGTAAGTTCTCCAGGCCGCTGTGGTTCTGATGTGTGGTAAACTGGTGCATAAGGAGATTGTTGGGGGTCAGGATGTTTCCGCTCGTCTTGTTTGGGATTGAAATTCCCACCTGGCGCCGAGACTTCGCCCTTCGGTTCTGGAACCAG
A/G CCTGAAGAGAAGATGGAGACATTAATTTAGGAATGTGAGGCCATTTGAATGAAATCTATAACATTCTTAGCACAAACATTTAGACAAAGATAGCTGCAGAAATGATCAGAGCTGCTTATTTGAATGGTTTAGTATTTGTTTTTACCATCAGAGTGGACCATAAAACCTACAAACCTTTATTTCTACATCACATGAAAGCTGAATAAATAAGAAGTCCACTGACATATGTTTCGTTAAGTTTGAACAATTGAACAATATTTGGATTGAGGTTAAAAAAATAAAAATAAATATAAAATCGAAATATTGAAGAAAATCACCTTTAAAGTTGATTATATTATAAATTAAAGTTAAACTAAATTATGATATTTATATCAAGACATTCAGTAAAAGGGGAAAATATTGTGAGACTGATAACAGCAGCCAGAAGAGAGAAAAACGTCAAATTTACTGTCCTGTCCTACAGATGCTACATTAGAAACATCTCGCTAAAGCAGTAATTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations