Transcript

cpda-201

ID
ZDB-TSCRIPT-240503-2
Name
cpda-201
Previous Names
None
Transcript Type
mRNA
Annotation Status
Annotation Method
Ensembl
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
ENSDART00000078035 [ Show ] (double-click sequence to select) [Download]
>tpe|ENSDART00000078035|gene_biotype:protein_coding|ENSDARG00000055648 transcript_biotype:protein_coding  ensembl:known chromosome:GRCz10:15:24821647:24858707:1
CCCCCGACGTCAGGCTAAAGAAAGAACCCGACCCAGCCGG
ACAGATTTTGGGATTTCATGAGGACGCCAAGGTGCCTTCG
GAAACATGTCGGGACAGAGGGCAAGAGACCTGTGTTCAGC
GAATAAATGCCCGCTGCTGCTTTTATCTCTGCTCGTTGTT
TATATCAGCTCCATCAACTCAGTTTCCGCAGGCGAGCTGA
AGACAGAGACTTACAACAAATACTACAATTACGACGAACT
TACCGAGCTTCTCAAAAGTCTCGCCGTTAAACACCCCAGC
ATCGCCAATCTGACCAGCATCGGCAGGTCCGTTGAAGGCA
GAGAGCTGTGGGTGATGAGAGTCACCAAAGACATCAGTGC
TGCTGATGGAACAGGAAAACCCAAATTCAAGTATGTGGGC
AACATGCACGGAGACGAGACCGTGTCCCGACAGGTGTTGG
TTTACCTGCTGGAGGACCTACTGGAGAAGTACGGGGAGGA
TCAGCGGGTCACGGAGCTCGTCAACACCACCGATATTTAC
ATCCTGCCGAGTATGAATCCTGACGGCTTTGAAAGGTCCG
TGGAGGGGGATTGTTTGGGCAAAGATGAGGGTCGGCATAA
TGCTAAAAACATCGACCTGAATAGAAGTTTCCCAGATCAG
TTTGAGGAAATACACTTGAATGCAGAAGACATCCCTGAAG
TTACTGCTGTCATAAAGTGGATCCTGGAGAACAAATTTGT
TCTCTCTGGTAATCTGCACGGCGGGACGGTAGTGGCCAGT
TATCCCTATGATGACTCTGCAGGTCATTCTACTGATGGCA
CCTATAGCAGATCTCCCGATGATGCCCTCTTCAGGCACTT
GGCCCTTGTTTACGCAGAGAATAACCCGGTTATGAAAACC
GGGCAGCCAAAGTGTGAGGACAACGTGAACGAATCCTTCC
CGGATGGCATCACAAATGGAGCAAAGTGGTATGACGTACC
AGGGGGTATGCAGGATTTCAATTACCTGAAGGGGAACTGT
TTGGAAATCACCATGGAACTCAGCTGCTGCAAATACCCAC
CCTCATCCCAACTCAAGACCGAATGGGAAAACAATCGTGA
CGCCCTACTGGCCTACATGGAGCAGATTCATATTGGAGTG
CGTGGCTTTGTAAGGGCCGCCAAAAATGAAGCTCCTATCG
CTGATGCTGTGATTATGGTTGCGGACATTAAACACAATGT
GAGCACCTCACGTTTTGGAGACTACTATCGTCTGTTGCTG
CCTGGCACCTACAGCATCACCGCGGTAGCACCGGGCTACA
TCCCTATGACTGTAGCTGGGGTGGAGGTAAAAGAGGGAAA
AGCAACTGTGCTGAATATCACCCTGTTGTCGGAGAATGAC
GAGAGATCCACAGCCACCCCAAACCCAGAATCCTCCACTG
ACACCTCTGCCAGCAGCTCTAACAGTGGCAGCACAGACAA
CAACAGCAACTCTGGTGCCAGCGACAAAGCAGCAGATCTC
ACAATACAGCCTCAGGAGTTCCGGCATCACCGGTACATTG
ACATGGAGCTGTTCATGAAGAAATTCAGCTCTGAGTACAG
CTCCATCACACGCCTCTATTCCATTGGGAAGTCTGTGCAG
AAACGTCTCTTGTGGGTCATGGAGATCTCCAACAATCCTG
GTGTCCACGAGTTAGGTGAACCGGAGTTTAAGTATATCGG
TAACATGCATGGCAATGAAGTGGTTGGTCGTGAATTGCTC
CTCAACCTCATTGAGTACCTGTGTCGCAACTATGGCACTG
ACCCTGAGGTCACCCAGCTTGTCGACACCACACGGATCCA
CATCATGCCTTCAATGAACCCGGATGGTTATGAAGTGTCC
CAAAAGGGAGATGTCGAAGGCATAAAGGGCCGTAACAACA
GTAAGAACTACGACCTGAACCGTAACTTTCCTGACCGGTT
CAAACTGATCACCGATCCCATCCAGCCAGAGACCCTGGCT
GTGATGAACTGGTCAAAGAACTACTCATTTGTGTTGTCTG
CCAACCTTCATGGAGGCTCTCTGGTGGTGAATTATCCATT
TGACGATAATCTTGAGGACGTTATCGGATACAGCAAGTCC
CCAGATGATGCTGTATTCAGGATGGTGGCTCTCGCTTACT
CTCAGGAAAACTCTGAAATGCATGAAGGTCACCCCTGTAA
GGAAATGAGTTCATACCCGGAATATTTTCAAGATGGCATC
ACCAATGGCGCAGCATGGTACAATGTCCACGGAGGAATGC
AGGACTGGAACTACATGAACACAAACTGCTTTGAGGTGAC
TATTGAACTGGGCTGTCACAAATATCCGCCAGTTGCGGAT
CTGCAGAAATACTGGGAACAAAACCGCAAATCACTTCTGC
AGTTCATCCATCAGGTCCACCGTGGAGTAAAAGGAATGGT
AATCGACAGCAAAGATGGATCTGGCATTCCCAATGCTACC
ATCACTGTGGAAACCATCCATCATCAAGTCACATCCAGTT
CTTTAGGGGACTACTGGCGCTTACTCGTTCCAGGAAAATA
CAAGCTGACTGCCTCTGCCCAAGGCTACATGTCAGATAGT
TCTTCTGTCACCGTGCCTAAGGACGGATTGGAGATTGTTA
ATTTCACACTGACCCGGATTCCCACACATGCAAACGGACA
GGAGACAGAAAACACAACCCCAGTTTTGGACCCCAGTGTA
AGGGAGTTTCAGGCCCTCATCAAGCAGCTGTCAACCCAAT
CCGGTTTGGACAAACTGATCCAGGACACTCCTACCGAGAG
TAGCTTCCGGTACCAGCAGTACGGCGAGGTTTCCGAGTTC
CTGCGTGGACTGACACTTAACTTTCCAGAGATTACTTCTC
TCCGCAGTCTTGGTCAGAGTGTGGAGATCAGGAATATCTG
GGCTCTGGAGATCTCCAACAATCCTAAAGTCCAAGAACCG
TCAAAGCCCAAGATCCGATTTGTAGCAGGAATCCATGGAA
ACGCACCAGTGGGCACAGAGCTGCTTCTGGAGTTTGCTGA
AAGTCTCTGTGTAAACTACGGCAAGAATGCAGCCATCAAC
AGGCTCATAAATGAGACAAGAATTGTTATCCTGCCAAGCA
TCAACCCAGATGGACGTGAGCTGGCGAAGGAAAGAGACTG
CACCTCCACTGTTGGCATGACCAATGTGCATGGCAAAGAC
CTTGACACTGACTTCATTGTAGGTAATGCATCTCAGCGAG
TTTCAGAACCTCAGCCAGAGACACGCGCTGTGATGAATCT
GATTCAGGAAAGAGGCTTCACTCTCTCTGTGGCTCTGGAT
GGAGGCTCATTGTTGGTCACTTATCCATATGACAAACCAG
TGCAAACCGTTGAAAATGATGACACACTGAGATATCTGGC
CACTGTGTATGCTGATCACCATCCCACAATGCACTTGGGT
AACACTGGATGTCCAAACAGCGTCCAAAGTAACATCCCTG
GTGGCGTCCTTCGAGCAGCAGTGTGGCACAGTCACATGGG
CAGCATGAAGGACTTCAGTGTGGACTTTGGTCACTGTCCC
GAGATCACAGTCTACACCAGCTGCTGTCTGTTTCCTTCAG
CTGAAATGCTGCCCTCGCTCTGGGCTGAGAACAGGAAGTC
TCTTCTGAGCATGCTGGTTGAGGTGCACAAAGGGGTTCGT
GGAATAGTCAAGGATAAGAACGGTAAGCCCATCGTGGGTG
CTGCAATTGTGTTGAACGGTGGTGTTCGAGTCTACACTAG
TGAAGGAGGGTATTTCCATGCTCTTCTGGCTCCTGGTTTA
CACAGCATTGAAGCGGTGGCTGATGGATACCAACAGCAAT
CACAGAAGGTGTCTGTGTCGCAATTTGAAGCAGCAAGTTC
CATTATCATTGAGTTTGACATGGAGAACGATATATTTGGC
CTTCCCAGAGAATTAGTAGTGGCGAGTGCAGCTGCCGCAA
TGACGGCACTAGTCTTGACCGCCTGTATCATCTGGTGCGT
CTGCTCGGCCAAATCCAACAGACATAAAGATGGCTTCCAT
CGACTACGGCAGCATCGAGATGATTATGACGACGAGGTCC
GCCTCATGTCTATGGGCTCCAAAAAGTCTCTCCTCAGTCA
TGAGTTTCAAGATGAGAGCGAAAGTGATGAGGATACACTG
TACACCAACAAACTCTGAGTCAGCCCACTGCAAGGCCAGC
AGAGGGCGTTCAATGTCCAAAACCGTCGGTAAACCACCAC
AGGATGCACTTTAATGGCCTGGTGAATTCGGGCAAGCTTT
TTTTCACCGTAGTGTATGCAAATAACCACTGCTCTCTCAA
CCAGCCTGCTTCGTTATCTGGGTCTCCGTAATTCTGGTCC
TCTACCCTTTAAAAAGGAAAGCGAAGAGCTAGAGTCCATC
TCAACAGGATTATGAAACACTGTGCCTTGTTAGATTAGAG
GATGCATGGTCGCTGCTGTGGTGAGGATGACGATTTTCTA
GTGTAAATGGAATTTTCCGCCCATTTTCTTTTTTTTTATC
CTTCTGTGGACCCGGATGGGTCAGGAATCCATCCATATGA
GAGTCTGGTCAGATCATCTGGATCATTATGAGTTGTCTTT
GCTGTTCTTTTTATGTGCAGCCAACAGAATGGCTAATATT
TCACATTATGGGGACTAATTAAGGCATTTCATAAGTGATA
TTAAAGAGATAGCTCATCCAAAAAAAAATGCTGTTAATCT
ACTCGCCTTTAGACAAGATAAGGTATATGTGACTATCTTC
AGTAAAACCTGTGGAGAAAAAAAACTGTTGCTCTTGGTGA
TTTAGAAAAAGTTAACCAATGCAATTGGCTATAGTCAATA
CAACTTTAAGTCAGAAAAACTTAAACAGGCAAGAACAACA
AGCTTCTGGCCATACGTTTGAGGCCTCATGAAGCAAAACA
ATAGGTCTGTAAACTGAATATTATTCATTTTTATTTATAA
ACAAATGTTACAGGAAACGTGTTGCATATTTAAACATATA
TGACGAGAAACTTGCGCTACCCTGGCTCACGCTGCTCCAC
ACTGCCCTGAACACACTCACAACTGTTTTCTGTAGCTGTG
GATTAAAGTTAATAATAATTCTGTGCCTTGACAACTGAAA
ACATCATAAATATCCACAGGGATTCATTTTGTCTTGCCTG
TTTTGACTCTCAAAATGCCAGCAGCCACTTTTTATGAATC
ACCAAGGTCTAAAAATTGTCCTTAATGTAGAAGAAAGCTA
CCAACATATTTGATGGTAAATTACCAGCAAATATTCAAGG
TTTTTGGGAAATCCACCAATGGGGGATAGTTCACACAAAC
ATAAATATGCTGTCATCATTTACATTTACTTTCATCTTCC
ACTTGTTTCAAACCTGTTGAACACAAAGGGAGAGATTTTG
AAGAATGTTTTAAAAACACTAACTTCCACAGTATTTTTTA
TGGATGTCATTGGCTGCCCAATACCCCCCCCCCCCCCCCC
CCCCCCCCTCTCCACCACCACCACCACCATTCCTTTAAAG
CAAGTAAATGGGCTCAATATATAAACTCTTTATTTTCAGC
AGAATTTTTTTTTTCACTTTAAACTACAAATGCTGGCCTT
AACCCATCTCGTTGACTTCTATAGTATATTTTATAGATGT
CAGATATTATATAGATGGCTTTTTTCCTCTTCCATTATTA
AAAATACTTTAATTTTGTGTTTAACAGAAGAAAGAATTTA
ATAAAAGTTTAGAACCACTTCAATCTGAGAAAATATTAAG
GGAATTTTCACTTTTTGGGGTGAATAAGCTCAACAGAGTG
CAAATTCCAAATATAAACTCAGTATTTTCAGCAGAACTGT
TTTAAAATTTACTTTTAAACTACTAATGCTGGCCTTAATC
CATCTCTGTGGATTATATCTCAACATAATTGAGCCCCATT
CACTTGTGGAGGAAAATGCTGAAATATTTTCATTTTCAAA
ACCTCAATTTCTCTTCAGCTAAAAAAAGCAAGCCATTTGC
ATGTTCGACAGCTCAGGATTGAGTATTAAATCAAGACGTT
TACATTTTTTTTTTTGGATGAACTATTCCTTTAAACATCT
CAGACTGCCAGAAATATATTGTCCAAGTTGTTTTCAGACA
AATGTAGATATTTACATTAAGCAGTCTCCCATTATTCATA
ATAAGAGTGACATGTTAGATACATAGCAGACAATTATGCT
CAATTACTGCCTTCTCAATTCTCTGTAATTTGGACAATCA
GGGATACGGTAAAACCTTAACATAACCTTAAAACTATGGA
TATGATCATGTTTAGTCAGTGTTTTTGGGTTGTTTTGTCT
TATTGTGCACTCTTTACATTGTTGTCCCAGTTTACTTTTT
AAACATATTTATTTTAGTTTTATCCATCCAATGAAAGACT
CCTCTCAGGCATCCCTGAAAGATCCAGAAGACCGATTTAT
TGAAATGTCATCACTTAGTTTAGTGTTTCTCAACCACGTT
CCTGGAGGACCACCAACACTGCATGTTTTGGATGTCTCCT
TAGTCTGTTACACCCATTACTGGTCTTTGAGAAACACTTA
AAAACTGGTTGAGAAACACTTATTTATTTGACACATTTAA
ATATTATTTGCAGTTCAGGGCATCCAGTGTATATTTAGAT
CTCAGTGACCAAGGGAAATCCTGTAAGTCTTTTACAAACT
CATCAAATATCTTGCTTTAGACGCTTCATATATGTATGTA
CAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations