Transcript

fcer1g-201

ID
ZDB-TSCRIPT-160623-15
Name
fcer1g-201
Previous Names
  • fcer1g-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063299 (1) [ Show ] (double-click sequence to select) [Download]
>OTTDART00000063299 ZDB-TSCRIPT-160623-15 cdna:known chromosome:VEGA67:7:18781616:18791134:-1 gene:OTTDARG00000043624.2 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:fcer1g description:Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
GTAGCTCGAGCGAAGCCCAAGTGTGTGTTGTCTGTGGTGG
TGCTGCTGCTGATGGTGGTGCTGATGAAGATCTTCTCTCT
TCTGTCTCTCTGGTTTTTCGGCAGTGCTGATGCGATGAGT
CTGAGGGAGCCGCAGATCTGCTATATTTTGGACGCGGTGC
TGTTTGTCTATGGGATTGTTCTCACTGTCCTGTACTGCAG
AATGAAGATGCGAAGTAAACAAGAACCAAAAAGCTCATAT
TCAGGGAAGAAAGATGCCGGTGAAGGGGTGTATGAGGGGC
TCAAACCTCATGAAACGGACACATACGAGACCATCAAGAT
GAAATCCGCCAAAAAATGAGACTCGCCACCAGAAGAAAAA
AGCCACCATCATCTCAAAACATCATGTAAATAAGCTGTTG
ACCTTAAGAAAAGGGTTTAAAGAGATTGTTCCAAAATAAT
ATAAATGTTTTATGAAAAATGTTGGAGTCATTGACTTTGG
TAGCTGGAGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations